Фон для презентации толерантность: Толерантность — презентация, доклад, проект

Содержание

Презентация «Правила толерантного поведения» — школьному библиотекарю, презентации

библиотека
материалов

Содержание слайдов

Номер слайда 1

Правила толерантного поведения. Памятка для школьников Подготовила: Фуфлыгина Наталья Николаевна,зав. библиотекой СКК МВД Россииг. Самара

Номер слайда 2

Толерантность. Толерантность — это ценность и социальная норма для кадета. Уважайте право всех быть различными. Уважайте разнообразие различных культур. Будьте готовы к пониманию и сотрудничеству с другими ребятами, различающимися по внешности, языку, обычаям и иным отличиям.

Номер слайда 3

Правилатолерантного поведения

Номер слайда 4

Умейтеслушать и слышать других людей. Если спорите, приводите аргументы, с интересом относитесь к оппонентам и старайтесь услышать друг друга.

Номер слайда 5

Стремитесьразобраться в проблеме. Решайте свои проблемы и сглаживайте конфликтысовместно, так вы сможетеусовершенствовать себя и отношения с другими людьми.

Номер слайда 6

Искреннеинтересуйтесь собеседником. Когда собеседник высказывает непривычный взгляд на вещиили приводит интересные аргументы, попробуйте встать на его место и оценить ситуацию его глазами – так вы откроете для себя его мир.

Номер слайда 7

друг друга. Когда человеку трудно быть одному в сложной ситуации, проявите сострадание и постарайтесь ему помочь. Поддержите

Номер слайда 8

Будьтеблагожелательными. Быть ежедневно толерантным просто – здоровайтесь первыми, подбадривайте друг друга.

Номер слайда 9

Не осуждайте людей. Люди вправе выбирать круг общения. Каждый может руководствоваться своими интересами. Каждый может высказывать альтернативное мнение и вправе проявлять негативные эмоции. Но они не должны задевать других.

Номер слайда 10

Информационные источники Фон боковой. Толерантность 1, 2, 3, 4 Поиск истины. Поддерживайте других. Протяни руку. Что посеешь. Интерактивная инфографика в Power. Point. Автор технологического приема Г. О. Аствацатуров. Справочник руководителя образовательного учреждения. 2018. №11. с.13. Подготовила Фуфлыгина Н. Н.,зав. библиотекой ФГКОУ СКК МВД Россииг. Самара

В Киеве состоялась презентация барабанной терапии для детей и молодежи с функциональными ограничениями (ФОТО)

16 ноября 2013 года к Международному Дню толерантности в Киеве в помещении библиотеки семейного чтения №160 состоялась презентация барабанной терапии для воспитанников Центра социально-психологической реабилитации детей и молодежи с функциональными ограничениями.

Мероприятие организовано при содействии и поддержке народного депутата Украины Дениса Дзензерского, Всеукраинской благотворительной организации «Волонтерское объединение «Крылья» и школы этнических барабанов «GoDoPaTa».

«Я убеждена, что именно толерантность, а не жалость и сочувствие, должна определять отношение общества к социально незащищенным категориям населения. Мы обязаны прочно укрепить в сознании современных детей это чувство, поскольку оно определяет моральное, общественное и демократическое развитие общества. Сегодняшнее семейное мероприятие — это прекрасный пример игры детей на равных в одном коллективе и, собственно, сосуществование в одном мире», – отметила глава ВБО «ВО «Крылья» Ярослава Токарь.

Читайте также: в Днепропетровске пройдут обучающие тренинги по финансовой грамотности 

Барабанная терапия является одной из методик реабилитации детей с ДЦП и аутизмом. Она положительно влияет на координацию движений рук и глаз, улучшает визуальное восприятие, а также повышает положительный эмоциональный фон детей, снижая тревожность.

В ходе презентации прошло показательное выступление старшей детской группы барабанной школы «GoDoPaTa Kids», а также детей с ограниченными возможностями, которые уже активно занимаются реабилитацией по данной методике.

После этого под чутким руководством тренера школы этнических барабанов «GoDoPaTa» Алены Красновской для детей и молодежи с ограниченными возможностями состоялся мастер-класс, на котором каждый ребенок смог попробовать себя в игре на африканском барабане.

По словам Алены Красновской, барабанная терапия подходит для людей с самыми разными проблемами: от наркотической зависимости до аутизма и от затруднений в учебе до психических расстройств. Оказывает положительное воздействие сразу по нескольким направлениям – может зарядить энергией или расслабить, создать бодрое, даже игривое настроение или дать выход гневу. Она может помочь покончить с социальной изоляцией, создать позитивные отношения. Во время игры на барабанах посредством ритмических упражнений решаются различные физические, психологические и обучающие задачи. Игра на ударных укрепляет иммунитет, снимает стресс и снижает кровяное давление.

«Если данная методика получит положительные отзывы после презентации, мы планируем и в дальнейшем развивать это направление, содействуя открытию постоянного кружка по обучению игре на этнических барабанах. Возможно, проведем презентацию в детском доме для детей с ограниченными возможностями в Днепропетровске, который мы систематически поддерживаем уже на протяжении года», – говорит народный депутат Денис Дзензерский.

В завершение презентации свое умение игры на барабанах детям, их родителям и представителям Центра продемонстрировали взрослая группа барабанной школы «GoDoPaTa Kan» и музыкальный коллектив «Cloud Jam».

 

Буклет на тему «Толерантность»

Толерантность

Сотрудничество, дух партнерства;

Готовность мириться с чужим мнением;

Уважение человеческого достоинства;

Уважение прав других;

Принятие другого таким, какой он есть;

Способность поставить себя на место другого;

Уважение права быть иным;

Признание многообразия;

Признание равенства других;

Терпимость к другим мнениям, верованиям и поведению;

Отказ от доминирования, причинения вреда и насилия.

Правила толерантного поведения

Относитесь к окружающим с уважением.

Никогда не думай, что твое мнение важнее мнение другого человека.

Не суди о ценностях других, отталкиваясь от своих собственных.

Не навязывай свое мнение другим.

Никогда не думай, что твоя религия в чем-то превосходит другую.

Помни, что каждый волен выбирать свой имидж и стиль, свои привычки и пристрастия.

    МБУДО «Станция детского технического творчества»

    г. Оренбурга

    Памятка

    по толерантности

     

    «Будь не таким, как другие, и позволь другим быть другими!»

    Термин «толерантность» происходит от лат. tolerantia – терпимость, устойчивость.

    Толерантность означает уважение, принятие и понимание того, что важно и дорого другому человеку, как он выражает себя, свою индивидуальность, чем он отличается от тебя. Толерантности способствуют знания. Широкое общение и свобода мысли, совести, убеждений.

    Толерантность – признание разнообразия окружающего мира, открытость, которая духовно обогащает. Чем больше в жизни разнообразия, тем интереснее и веселее жить.

    «Дружба – это самое необходимое для жизни, т.к. никто не пожелает себе жизни без друзей, даже если бы он имел всё остальные блага»?

    Аристотель

    Притча о дружбе

    Как –то два друга много дней шли по пустыне. В какой – то момент друзья поспорили, и один из них сгоряча дал пощёчину другому. Последний, чувствуя боль ни ничего не говоря, написал на песке: «Сегодня мой самый лучший друг дал мне пощёчину».

    Они продолжали путь, и пришли к морю, в котором решили искупаться. Тот, который получил пощёчину, едва не утонул, не утонул, но его друг спас. Когда он пришёл в себя, он написал на камне: «Сегодня мой лучший друг спас мне жизнь». Тот, который дал ему пощёчину, а потом спас жизнь, спросил его:

    — Когда я тебя обидел, ты написал на песке, а теперь ты пишешь на камне. Почему?

    Друг ответил:

    — Когда кто – либо нас обижает, мы должны это на песке, чтобы ветры могли стереть это. Но когда кто – либо делает что – либо хорошее, мы должны высечь это на камне, чтобы никакой ветер не смог стереть это.

    Шаблоны презентаций о биографии. PowerPoint Фоны для презентаций

    Описание структуры карты рисков

    На этой карте рисков вероятность или частота отображается по вертикальной оси, а сила воздействия или значимость — по горизонтальной оси. В этом случае вероятность появления риска увеличивается снизу вверх при продвижении по вертикальной оси, а воздействие риска увеличивается слева направо по горизонтальной оси.

    Арабские цифры на карте – обозначения рисков, которые были классифицированы по четырем категориям значимости и шести категориям вероятности, причем так, чтобы каждому сочетанию вероятность/значимость был приписан один вид риска.

    Такая классификация, размещающая каждый риск в специфическую отдельную «коробочку» не является обязательной, но упрощает процесс установки приоритетов, показывая положение каждого риска относительно других (увеличивает разрешающую способность данного метода). Жирная ломаная линия — критическая граница терпимости к риску.

    При выявлении критических рисков сценарии (причинно-следственная связь процессов, событий и действующих факторов риска), приводящие к рискам выше этой границы, считаются непереносимыми.

    При разработке стратегии снижения рисков например, по выявленным непереносимым рискам до принятия данной стратегии требуется понять, как уменьшить или передать такие риски, в то время как риски ниже границы являются управляемыми в рабочем порядке.

    Построение карты рисков

    В общем случае процесс картографирования рисков позволяет:

      выделить риски

      расположить риски по приоритетам

      оценить количественно (разбить на классы) риски организации.

    Для составления карты рисков можно применить:

      интервью

      формализованные и неформализованные опросники

      обзоры и исследования отрасли

      анализ документационного комплекта компании

      численные методы оценки

    Основные шаги процесса самостоятельного картографирования рисков

      первичное обучение

      определение границ анализа

      формирование состава команды

      анализ сценариев и ранжирование

      определение границы терпимости к риску

      составление плана действий

      технологии количественных оценок и моделирования

    При определении границ должен соблюдаться баланс между:

      широтой границ

      глубиной информации

      ценностью той информации, которая будет получена из процесса картографирования рисков.

    Таблица результатов сценарного анализа и ранжирования рисков

    Объект риска

    Триггерный механизм

    (или фактор риска)

    Последствия (описания)

    Воздействие

    (значимость или величина потерь)

    Вероятность потерь

    …………………..

    ………………..

    …………………..

    ………………..

    …………………..

    ………………..

    …………………..

    ………………..

    Тема 5 Методы управления риском

    1. Классификация методов управления рисками

    2. Методы уклонения от риска

    3. Методы локализации риска

    4. Методы диссипации (распределения) риска

    5. Методы компенсации риска

    1. Классификация методов управления рисками

    Сами по себе методы риск-менеджмента достаточно разнообразны. Это связано с неоднозначностью понятия риска и наличием большого числа критериев их классификации. В следующем разделе данной главы мы более подробно рассмотрим основные методы, а здесь ограничимся лишь кратким их обзором.

    Во – первых, подходы к управлению рисками можно сгруппировать как методы минимизации негативного влияния неблагоприятных событий следующим образом.

      Дособытийные методы управления рисками – осуществляемые заблаговременно мероприятия, направленные на изменение существенных параметров риска (вероятность наступления, размеры ущерба). Сюда можно отнести методы трансформации рисков (Risk control, Risk control to stop losses), которые связаны, в основном, с препятствованием реализации риска. Обычно эти методы ассоциируются с проведением превентивных мероприятий.

      Послесобытийные методы управления рисками – осуществляемые после наступления ущерба и направленные на ликвидацию последствий. Эти методы направлены на формирование финансовых источников, используемых для покрытия ущерба. В основном это методы финансирования риска (Risk financing, Risk financing to pay for losses).

    Послесобытийные и дособытийные методы объединяются в общем направлении методов компенсации.

    Методы управления рисками можно разделить на четыре группы:

        методы уклонения от риска;

        методы локализации риска;

        методы диссипации риска;

        методы компенсации риска.

    Методы уклонения от риска предполагают:

      исключение рисковых ситуаций из бизнеса;

      избегание сделок с ненадежными партнерами, клиентами;

      отказ от услуг неизвестных или сомнительных фирм;

      отказываются от инновационных или инвестиционных проектов, если те вызывают хоть малейшую неуверенность в успешной реализации.

    Если руководство решает использовать в качестве «уклонения» — страхование то необходима разработка комплексной программы защиты, а не единичные обращения в страховую фирму.

    Если у предприятия не хватает средств для комплексной страховой защиты, необходимо выделить те риски, реализация которых связана с наибольшими потерями и застраховать именно их.

    Метод локализации риска

    Применяется только, когда можно четко идентифицировать источники риска.

    Наиболее опасные участки производственного процесса локализуются, и над ними устанавливается контроль, снижается уровень финансового риска.

    Подобный метод используют крупные компании для внедрения инновационных проектов, освоения новых видов продукции и т. д.

    В самых простых случаях для локализации риска создается специализированное подразделение в структуре компании, которое осуществляет реализацию проекта.

    Методы диссипации (рассеивания) риска

    Представляют собой более гибкие инструменты управления. Один из них связан с распределением риска между стратегическими партнерами. В качестве партнеров могут выступать как другие предприятия, так и физические лица. Здесь могут создаваться акционерные общества, финансово – промышленные группы. Предприятия могут вступать в консорциумы, ассоциации, концерны.

    Объединение предприятий в одно либо в группу носит название интеграции .

    Выделяют четыре основных вида интеграции риска:

      (обратная) интеграция — предполагает объединение с поставщиками;

      (прямая) интеграция подразумевает объединение с посредниками, образующими дистрибьюторскую сеть по сбыту продукции предприятия;

      горизонтальная интеграция предполагает объединение с конкурентами; обычно такие ассоциации создаются с целью согласования ценовой политики, разграничению зон хозяйствования, каких-либо совместных действий;

    Другая разновидность методов диссипации риска – это диверсификация .

    подразумевает увеличение разнообразия видов деятельности, рынков сбыта или каналов поставок.

    Диверсификация закупок – это увеличение количества поставщиков, что позволяет ослабить зависимость предприятия от конкретного поставщика. (нарушение графика, форс – мажор, банкротство и др.)

    Диверсификация рынка сбыта (развитие рынка) — предполагает распределение готовой продукции предприятия между несколькими рынками или контрагентами. В этом случае провал на одном рынке будет компенсирован успехами на других.

    Диверсификация видов хозяйственной деятельности — подразумевает

    расширение ассортимента выпускаемой продукции, оказываемых услуг, спектра используемых технологий. При возникновении проблем с реализацией одного вида продукции, организация сможет компенсировать потери при помощи других сфер хозяйствования либо вообще перейти в другую отрасль.

    Диссипация риска при формировании инвестиционного портфеля

    предполагает реализацию одновременно нескольких проектов, характеризующихся небольшой капиталоемкостью. Это можно назвать диверсификацией инвестиций .

    Методы компенсации риска

    Данная группа методов относится к упреждающим методам управления

    (управление по изменениям).

    1. С тратегическое планирование особенно эффективно, если

    разработка стратегии проходит через все сферы внутри предприятия.

    Разработка комплекса компенсирующих мероприятий, создания и использования резервов.

    Представители разных отраслей экономики — в том числе и наши клиенты — зачастую задают нам, как консультантам по управлению рисками вопрос: есть ли простые и наглядные методы, доступные и неспециалистам, которые помогли бы хотя бы грубо оценить риски при развитии новых стратегических направлений бизнеса, крупных инвестиционных планов и т.п. Бывает, что в процессе разработки стратегии оценивается до десяти возможных стратегий. Каждой из них свойственен свой набор зачастую катастрофических рисков. Так есть ли способ быстрого и сжатого отображения деловых рисков вашей организации, препятствующих достижению стратегических целей. Как на нескольких страницах описать детали этих рисков, а также состав действий по их снижению или устранению, как установить и распределить временные рамки выполнения работы, меры успеха и исполнителей, ответственных за успешное выполнение?

    Это можно сделать при помощи построения карты рисков вашей организации или отдельного стратегического направления развития бизнеса.

    Что такое карта риска и чем она полезна?

    Карта риска — графическое и текстовое описание ограниченного числа рисков организации, расположенных в прямоугольной таблице, по одной «оси» которой указана сила воздействия или значимость риска, а по другой вероятность или частота его возникновения. На рисунке 1 показан частный пример карты рисков.

    Ч то Вы можете сделать сами: процесс построения карты риска.

    В общем случае процесс картографирования рисков — часть систематической, охватывающей все стороны деятельности компании методологии, позволяющей выделить, расположить по приоритетам, и оценить количественно (разбить на классы) риски организации. Методы, которые применяют консультанты при составлении карты рисков, включают интервью, формализованные и неформализованные опросники, обзоры и исследования отрасли, анализ документационного комплекта компании, численные методы оценки и т.п. Необходимо отметить, что в том случае, когда идет речь об оценке финансовых рисков, важным является именно количественный анализ финансовой отчетности компании. Конечно, индивидуальные характеристики компании-клиента и его потребности диктуют соответствующий метод сбора и анализа данных.

    Мы опишем пример процесса самостоятельного картографирования рисков при решении задачи выявления критических для организации рисков (угрожающих существованию организации), выдвигая на первый план только главные шаги. Эти шаги включают первичное обучение, определение границ анализа, формирование состава команды, горизонты времени, анализ сценариев и ранжирование, определение границы терпимости к риску, составление плана действий, технологии количественных оценок и моделирования.

    Первичное обучение.

    При составлении карты рисков организации очень важно, чтобы хотя бы один или два сотрудника компании, прошли обучение основам риск-менеджмента. Они в дальнейшем помогут наладить диалог между членами команды и вести всю команду во время процесса картографирования. Для этого необходимо провести предварительное обучение, которое может длиться от одного до пяти дней. По нашему опыту, наилучший результат достигается при длительности установочных семинаров в два-три дня. Роль такого обученного сотрудника компании — менеджер процесса картографирования рисков внутри компании, постоянно ориентирующий команду на нужную цель. В тех случаях, когда требуется специальная предметная экспертиза, эксперт может быть введен в команду. Конечно, если Ваша организация располагает большим количеством грамотных специалистов, это усилит команду.

    Не доверяйте работу дилетантам. Если Вы не намерены обращаться к консультантам, обучите своих сотрудников.

    Границы анализа.

    Границы анализа, определяющие, какие области бизнес-решений затрагивает картографирование, определяются на начальном этапе процесса. Консультанты по управлению рисками также делают это на первом этапе обследования организации. В рассматриваемом примере границы определим как идентификацию, установление приоритетов и понимание всех рисков, препятствующих достижению корпоративных стратегических целей при реализации конкретного стратегического плана. Отметим, что границы анализа могут быть столь широкими или столь узкими, как это желательно организации. Однако должен соблюдаться баланс между широтой границ, глубиной информации и ценностью той информации, которая будет получена из процесса картографирования рисков. Например, ценность одной карты риска для всей компании может быть значительно меньше, чем карт риска для каждого бизнес-подразделения или какой-то одной деловой единицы компании, а может быть и наоборот.

    Определитесь с целями, доступностью и стоимостью информации. Затем уже очертите границы анализа для построения карты рисков.

    Состав команды.

    Состав команды является критическим для успеха процесса картографирования рисков. При проведении работы профессиональными консультантами команда (рабочая группа) включает обычно топ-менеджмент компании, т.е. тех специалистов, которые обладают опытом и экспертными знаниями. В случае самостоятельного картографирования рисков консультант — это по сути «коллективный разум» топ-менеджмента организации, направляемый прошедшими обучение сотрудниками. Опыт показывает, что команда работает эффективно, если состоит из шести — десяти человек.

    Только определив границы анализа, можно определить, кто включается в команду. При составлении карты стратегических рисков компании, например, в команду включаются главный администратор, руководитель финансового отдела, руководитель казначейства, руководитель юридического, контрольного, IT отделов, руководитель отдела стратегического планирования, если таковой отдел имеется в компании. Если компания уже имеет отдел риск менеджмента, то, конечно же, его руководитель включается в рабочую группу.

    Для более узких границ, таких как выявление и картографирование рисков специфического подразделения или операционной бизнес-единицы, команда будет состоять из топ-менеджмента команды управления подразделения. Или, если анализируются риски определенной области деятельности типа электронной коммерции, то состав команды будет формироваться из старших представителей соответствующих функциональных областей и тех подразделений, интересы которых затрагиваются.

    Наиболее важно, чтобы команда наиболее репрезентативно представляла институциональные знания своей компании и включала топ-менеджмент.

    Сценарный анализ и ранжирование.

    На этом шаге команда предпринимает управляемый мозговой штурм, чтобы выявить все потенциальные риски компании при данной стратегии развития и сценарии, сопутствующие их появлению. После того как они идентифицированы, риски и сценарии обсуждаются, достигается консенсус и готовится письменное описание сценариев. Ключевыми моментами каждого сценария являются «уязвимость» компании (объект риска), «триггерный механизм» (факторы риска) и «последствия» (величина возможных потерь).

    Уязвимость или объект риска — это ценность компании, которой свойственна подверженность потенциальным угрозам. Триггерные механизмы (факторы риска) вызывают негативные последствия для объектов риска. Последствия выражаются в терминах природы и величины потерь, следующей из уязвимости объекта риска и природы триггерного механизма. При этом бывает так, что с виду непохожие сценарии и триггерные механизмы, приводящие к одинаковым последствиям для объекта риска, объединяются, при их рассмотрении с высоты птичьего полета в один сценарий. Уже на этом этапе работы нужно стремиться понять, можно ли множество мелких рисков, которые, как правило, выявляют сотрудники организации при самостоятельной работе, объединить в какие-то группы, на основании чего это можно сделать.

    Когда выявлено ограниченное количество сценариев, и достигнут консенсус, команда должна ранжировать сценарии в терминах «воздействия» и «вероятности». Команда определяет и воздействие и вероятность в тех терминах, которые релевантны для организации. Например, в качественных терминах четыре ранга воздействия можно определить в нисходящем порядке как (1) катастрофический, (2) критический, (3) существенный, и (4) граничный. Ранги вероятности, которых на нашей карте шесть, определены также в качественных терминах от «почти невозможно» к «почти точно произойдет». Как вероятность, так и значимость могут также в принципе быть оценены компанией количественно. Команда может использовать любые количественные определения, однако, эта процедура намного более сложна и требует значительного времени на анализ.

    Определение границы толерантности к риску.

    Критическая граница терпимости к риску — ломаная жирная линия, отделяет те риски, которые являются в настоящее время терпимыми от тех, которые требуют постоянного контроля и именно сейчас. Деловые риски, расположенные выше и справа от границы считают «невыносимыми» и требуют непосредственного внимания с точки зрения управления. В случае разработки стратегии организации желательно до принятия стратегии понять, как ими управлять или устранить их, не приведет ли это к такому снижению доходности бизнес, что стратегия станет непривлекательной? Те угрозы, которые расположены ниже и слева от границы, в настоящее время считаются терпимыми (это не значит, что ими вообще не нужно будет управлять).

    Граница толерантности к риску изменяется в зависимости от аппетита организации на риск. При классификации рисков по значимости/вероятности даже без численной оценки можно примерно оценить величину финансовых потерь от того или иного риска, что позволяет определиться в какой-то мере с аппетитом организации на риск и определить границу терпимости к риску на карте.

    А вот и карта риска!

    Заключительный шаг в построении карты — размещение деловых рисков на карту рисков на основании ранга их воздействия и ранга вероятности, т.е. по сути, классификация рисков по двум параметрам. В общем, более сложном случае таких параметров может быть и три и пять. Тогда уж без математики не обойтись. В нашем примере параметра два, и команда стремится разместить каждый риск в соответствующую ячейку воздействия / вероятности. При этом в одну ячейку попадает только один риск.

    Важно понять, что окончательная ценность карты риска организации состоит не в определении точного воздействия или уровня вероятности специфической угрозы, а в относительном расположении одной угрозы относительно других угроз, и в их расположении по отношению к границе терпимости к риску. Теперь, чтобы принять данную стратеги, если она устраивает нас по параметрам доходности, важно понять, как все риски, лежащие в красно-сиреневой зоне «нетерпимости», перевести в зеленую зону.

    План действий.

    Риски, лежащие выше границы толерантности требуют непосредственного внимания именно сейчас. Поэтому важно разработать определенные планы действий для уменьшения величины или вероятность потерь от данного риска. Необходимо также определить целевые показатели и меру оценки успеха в управлении риском, даты достижения целевых показателей и назначить ответственных. Цель плана действий в данном случае состоит в том, чтобы понять, как переместить каждый «невыносимый» риск левее и ниже в «терпимую зону». Здесь следует заметить, что нужно соотносить затраты на такое перемещение с выгодами от него, а также учитывать, что сильное снижение рисков компании может привести и к потере ею большей части доходности.

    Количественная оценка и моделирование.

    Степень необходимой при анализе детализации специфична для каждого риска и изменяется от одного риска к другому, а зависит, в основном, от целей, которые преследует организация. Если западные банки зачастую борются за доли процента при оценке возможных потерь, то даже нашим банкам, не говоря уж о предприятиях реального сектора экономики, пока такая точность не нужна. Вообще при оценке достаточно широкого круга деловых рисков существенная детализация не требуется или не может быть произведена. Другие риски и планы действий будут требовать более детального исследования и количественной оценки, чем это может быть достигнуто в процессе анкетирования, мозговых штурмов или изучения отраслевых данных и т. п.

    Для рисков, требующих дополнительного анализа, необходимо использовать сложные количественные оценки и методы моделирования.

    Карта риска — картинка или процесс?

    С точки зрения технологии управления риском с построением карты рисков процесс управления не завершается, а только начинается. Более того, карта риска вашей компании — это «живой организм», который реагирует на принимаемые решения и выполняемые операции. Она живет и развивается с развитием вашего бизнеса, вместе с новыми возможностями появляются новые риски, некоторые из старых рисков утрачивают актуальность и становятся незначимыми для вашего бизнеса. Поэтому важно, чтобы процесс картографирования риска, уточнения карты был встроен в действия организации.

    Это позволит проводить актуализацию рисков компании с той периодичностью, которая необходима. Обычно срок «плановой актуализации» составляет год, иногда ее привязывают к сезонным циклам, если они имеют место в бизнесе и т.п. Однако при появлении даже слабых сигналов о событиях, которые могут сильно повлиять на объекты риска компании, следует оценить их влияние на карту рисков компании вне всякой периодичности.

    Создание ценности для компании.

    Картографирование рисков компании необходимо использовать для проверки существующих стратегий в контексте реализованных и нереализованных рисков и возможностей компании для генерации доходности, а также для поддержки принятия управленческих решений по развитию новых стратегических направлений.

    Рассмотрим традиционные подходы к стратегическому планированию. В то время как большинство компаний выполняет какой-либо тип формального стратегического планирования (они все хорошо известны), у компаний нет бизнес-процесса для идентификации, оценки и интеграции возможностей и рисков, т.е. некоей «обучающей стратегии». Это легко может быть проиллюстрировано на примере электронной коммерции, где традиционные стратегические методы планирования не могут справиться со скоростью происходящих изменений. Характер технологических изменений свидетельствует, что те основания (доходность и риски), которые считаются правильными для многих из сегодняшних решений, очень вероятно, не будут таковыми уже через шесть месяцев, и не будет иметь никакого сходства с теми, которые будут иметь место через три года.

    Имеется разрыв между теми, кто обычно проводит стратегический процесс планирования, и теми, кто взаимодействует с клиентами и ответственны за выигрыш или фактические деловые потери в текущем процессе деятельности. Традиционные «стратегические планировщики» полагаются на знание, доступное в определенной точке времени, в то время как линейное управление полагается на «живое» знание, основанное на фактической рыночной динамике, которое можно назвать «обучающей стратегией». Деловой успех зависит от качества решений, сделанных в динамическом настоящем. Перманентный процесс картографирования риска, нацеленный на стратегию компании, может ликвидировать или уменьшить разрыв между «планировщиками стратегии» и линейными менеджерами, включая «живую» рыночную информацию о том, где конкурентоспособное преимущество компании фактически может быть реализовано.

    Таким образом, картографирование риска является мощным аналитическим инструментом для того, чтобы разобраться в деловых рисках компании и расположить их по приоритетам. Помимо этого во многих случаях карта рисков является источником для создания экономической ценности компании, т.к. уже сейчас ясно, что эта методология может применяться и сверх процесса управления рисками как такового. Она играет важную роль в стратегическом и текущем планировании, осуществлении существующей и оценке будущих деловых стратегий.

    Или иных методов либо их комбинации) необходимо обработать и наглядно представить для того, чтобы проводить с ними дальнейшую работу по оценке и управлению. Наиболее наглядный, простой и популярный способ – построение карты или матрицы рисков .

    Самый простой вариант представления информации о рисках – составление перечня рисков в порядке убывания характеристик их важности.

    Однако важность риска с точки зрения управления не определяется одним параметром, что связано с его вероятностной природой. Очевидно, что риск, который в случае реализации несет большие потери, можно считать опасным и требующим управления. Но если вероятность наступления этого риска крайне мала, то им можно и пренебречь. Соответственно и наоборот: риск с небольшим потенциальным убытком, но реализующийся очень часто, в итоге приведет к значительному суммарному ущербу. Следовательно, характеризовать каждый идентифицированный риск необходимо с помощью двух его основных параметров: вероятности реализации и величины возможного ущерба.

    Отметим, что хотя последствия реализации рисков бывают не только финансовыми, но и моральными, репутационными, сопровождающимися потерей жизни и здоровья и т.д., но в экономических ситуациях принято рассматривать в качестве основных именно финансовые, материальные. Это связано с тем, что в экономической деятельности именно такого рода потери имеют наибольшее значение, а также тем, что в большинстве случаев остальные потери можно, хотя и с определенной степенью условности, выразить в стоимостном выражении.

    Таким образом, каждый идентифицированный риск в случае проведения его оценки будет характеризоваться двумя величинами: вероятностью его наступления и размером убытков. Перечень рисков можно составить, расположив риски в порядке убывания одной из величин, однако общепринятым является одновременное использование обоих показателей с построением так называемых карты или матрицы рисков .

    В том случае, если обе величины – вероятность реализации риска и потенциальный ущерб – имеют количественное выражение, мы можем построить карту рисков .

    Карта рисков – это наглядное изображение идентифицированных рисков в виде точек на координатной плоскости, где по одной из осей (как правило, OY), отложены вероятности реализации рисков (в долях единицы или в процентах), а по другой (как правило, ОХ) – ущерб от реализации (в денежных единицах). Пример карты рисков можно видеть на рисунке 1.

    Рисунок 1 – Схематичное изображение карты рисков

    Как видно на рисунке, риски 1 и 4 имеют одинаковую величину потенциального ущерба, однако вероятность реализации риска 1 выше. Риски же 2 и 5 имеют одинаковую вероятность реализации, при этом потенциальный ущерб выше у риска 5. Эти пары рисков можно сравнить и сказать, какой из них обладает более высоким уровнем (если за уровень риска принять пару вероятность/ущерб). Однако в отношении других рисков такое сравнение затруднительно. Так, риск 1 имеет меньший ущерб, чем риск 5, однако вероятность его реализации существенно выше.

    Для того, чтобы определить, является риск приемлемым или нет, на карту рисков можно нанести границу толерантности к риску , или границу приемлемости риска (см. рис. 1). Она представляет собой кривую, так как риски с высоким ущербом даже при низкой вероятности могут считаться неприемлемыми, также как и риски с небольшим ущербом, но высокой вероятностью. Строится она на основании представлений о риск-аппетите организации , и отделяет область приемлемых рисков, то есть тех, которые организация принимает и управляет ими, от неприемлемых. Неприемлемые риски – это риски, от которых при невозможности управления ими таким образом, чтобы они в результате попали в область приемлемых рисков, организация отказывается. В зависимости от политики управления рисками и конкретной сущности рисков, от неприемлемых рисков можно отказываться и сразу, без выяснения возможностей управления ими.

    Для повышения наглядности риски на карте, помимо номеров, могут обозначаться разными цветами в зависимости от их вида. Карта рисков должна обязательно снабжаться перечнем рисков.

    Таким образом, карта рисков представляет собой очень наглядное и достаточно простое в построении изображение рисков предприятия или организации.

    Однако в ряде случаев нет возможности измерить вероятность и ущерб в количественном выражении. Особенно это касается вероятности. Тем не менее, существует необходимость в некотором ранжировании рисков по величине вероятности их реализации. В этом случае используют качественные, атрибутивные оценки вероятности типа «весьма вероятно», «маловероятно», «невероятно» и т.д. Количество градаций качественной шкалы может быть любым. Аналогично оценивается и ущерб, например как «высокий», «средний» и «низкий». Количество градаций по шкалам вероятности и ущерба может быть как равным, так и различным.

    На основе этой информации строится матрица рисков – изображение рисков в виде таблицы, где по столбцам расположены градации величины ущерба от реализации рисков, а по строкам – градации вероятностей их реализации. Сами риски при этом располагаются в клетках таблицы. Каждая клетка имеет интерпретацию с точки зрения уровня риска. Наглядно пример матрицы рисков представлен в таблице 1.

    Таблица 1 – Матрица оценки рисков (пример)

    В матрице рисков также можно изобразить границу толерантности к рискам, однако чаще принято клетки таблицы окрашивать в разные цвета: зеленый – низкий риск, желтый – средний риск, красный – высокий риск (чем насыщеннее красный цвет, тем выше риск). Такой вариант изображения является более наглядным.

    Также клеткам таблицы могут приписываться некоторые величины (см. табл. 1), отражающие уровень риска. На основе этих величин могут производиться вычисления, например, суммарного риска. Однако эти величины носят условный, произвольный характер, как и вычисления на их основе, и считать их статистическими характеристиками нельзя.

    Качественные оценки вероятности и ущерба для каждого риска могут быть получены двумя способами.

    В первом случае они могут быть определены из количественных оценок, то есть являться их упрощением. Например, политикой в отношении риск-менеджмента определено, что риск с вероятностью от 0 до 0,05 является крайне низким, от 0,05 до 0,1 – низким, от 0,1 до 0,4 – средним, от 0,4 до 0,7 – высоким и от 0,7 до 1 – крайне высоким. Имея оценки вероятностей реализации идентифицированных рисков мы можем превратить карту рисков в матрицу. Аналогично и с величиной потенциального ущерба. В этом случае построение матрицы рисков может являться хотя, возможно, и более наглядным, однако менее информативным способом представления информации о рисках, чем карта рисков.

    Однако чаще матрица рисков строится тогда, когда получить количественные оценки рисков не представляется возможным. Например, нельзя оценить вероятность реализации рисков ни с помощью методов теории вероятностей, ни на основании данных соответствующей статистики. В таких случаях могут использоваться так называемые субъективные вероятности, либо экспертные оценки , либо просто результаты обработки риск-интервью о том, как часто реализуются (или могут реализовываться) те или иные риски по мнению опрашиваемых лиц. Очевидно, что более достоверными в данном случае будут оценки, полученные в качественном, а не в количественном виде. В таких ситуациях использование матрицы рисков является не только наглядным и удобным, но и достаточно достоверным (в случае соблюдения правил получения качественных оценок) способом представления информации о рисках предприятия или организации.

    Важно отметить, что «вероятность», используемая для составления матрицы в подобных случаях, как правило, не является вероятностью в классическом или статистическом смысле. В англоязычной литературе для ее обозначения используется термин likelihood , который можно перевести, как «правдоподобие», а в контексте рисков – как «возможность реализации рисков». Понимая при этом, что вероятность – это мера возможности реализации рисков, однако слово «возможность» скорее можно трактовать, как качественную, а не количественную характеристику.

    Таким образом, карта и матрица рисков представляют собой, по сути, один и тот же способ представления информации о рисках, отличаясь друг от друга типом оценок характеристик риска.

    Литература

    1. Синявская Т.Г., Трегубова А.А. Управление экономическими рисками: теория, организация, методы. Учебное пособие. / Ростовский государственный экономический университет (РИНХ). – Ростов-на-Дону, 2015. – 161 с.

    МЕОЦ. Синагога в Марьиной роще. Евреи Москвы.

    С 16 по 20 ноября в Российском Еврейском музее и Центре толерантности в Москве пройдет “Неделя толерантности” – цикл мероприятий, приуроченных к Международному дню толерантности.

    Ежегодный комплекс в этом году будет представлен как ставшими уже популярными, так и совершенно новыми для Центра проектами, предназначенными для представителей всех целевых аудиторий.

    В этом году программа Недели толерантности включает квест-игры для младших школьников, интерактивные спектакли, дискуссионные киноклубы для подростков и молодежи, музыкальные и художественные мастер-классы на социально-значимые темы, презентации новых программ Центра толерантности, дискуссии и круглые столы на актуальные темы в работе с молодежью, выставки плакатов и фотографий.

    ПРОГРАММА:

    16 ноября

    ОТКРЫТИЕ ВЫСТАВКИ СОЦИАЛЬНЫХ ПЛАКАТОВ “НАМ, МОЛОДЫМ, НЕБЕЗРАЗЛИЧНО!

    Создание социальный плакат – хороший повод для молодежи продемонстрировать не только свое творческое видение, но и активную гражданскую позицию, поскольку темы для плакатов отвечают актуальной социальной проблематике.

    В конкурсе участвуют работы школьников и студентов образовательных организаций Москвы.

    Номинации конкурса:

    1. “Проблема межкультурного диалога”

    2. “Проблема отношения к социально-уязвимым группам”

    3. “Проблема отношений между людьми”

    Авторы работ, а также любые заинтересовавшиеся зрители смогут принять участие в интерактивной программе, приуроченной к открытию выставки. Тогда же состоится и награждение победителей.

    16.11 / 15:00 – 17:00

    Выставка продлится в течение Недели толерантности.

    СПЕКТАКЛЬ ФОРУМ-ТЕАТРА “ТРАВЛЯ”

    Интерактивный спектакль, где каждый зритель может стать и актером, и режиссером, предложив свое решение затронутой проблемы и самостоятельно попробовав его на сцене на месте одного из героев, посвящен проблеме травли (или буллинга) в школе. Форум-театр не дает готовых ответов, а предлагает зрителям задуматься.

    16.11 / 15:00 – 17:00

    ДИСКУССИОННЫЙ КИНОКЛУБ “ЗА И ПРОТИВ”

    Программа подросткового дискуссионного киноклуба “За и Против” разработана с целью привлечь внимание подростков к наиболее значимым социальным проблемам современности.

    Каждый киноклуб открывается просмотром документального фильма на актуальную тему, после чего ведущий киноклуба предлагает обсудить увиденное в формате интерактивной дискуссии.

    Задача дискуссии – не только дать подросткам возможность услышать различные мнения, но и привить уважение к личности других людей, умение отстаивать свою точку зрения.

    Киноклубы проходят ежемесячно, и каждый раз назначается новая тема для обсуждения.

    Тема ноября: отношение к женщинам в современном мире.

    16.11 / 16:00 – 18:00

    17.11 / 16:00 – 18:00

    ЗАСЕДАНИЕ РАБОЧЕЙ ГРУППЫ ПРЕФЕКТУРЫ СВАО ПО ВОПРОСАМ ПРОФИЛАКТИКИ ЭКСТРЕМИЗМА

    Сотрудники Центра толерантности являются постоянными членами рабочей группы по профилактике ксенофобии и экстремизма. Очередное заседание, приуроченное к Международному дню толерантности, проходит на площадке Центра.

    На повестке дня отчеты по деятельности муниципалитетов за прошедший отчетный период, а также тематические мастер-классы от Центра толерантности по вопросам профилактики экстремизма.

    16.11 / 16:00 – 18:00

    “МЫ И ОНИ”. ПЕРФОРМАНС ПЛЕЙБЕК-ТЕАТРА “АЛХИМИЯ”

    Плейбек-театр сложно описать словами. На сцену выходят актеры и ведущий, они задают тему, а дальше начинается диалог с залом: у кого есть ассоциации? Воспоминания? А может быть, целые истории?

    Зрители делятся, а актеры, которые слышат рассказы впервые, импровизируют, пропуская сюжет через себя. В результате получается удивительный сплав личного опыта, переживаний и социальной проблематики, без которой не обходится ни одна личная история.

    16.11 /19:00 – 21:00

    17 ноября

    СПЕКТАКЛЬ ФОРУМ-ТЕАТРА “СОСЕДИ”

    История стара, как мир: юноша и девушка, влюбленные друг в друга. Оба заканчивают школу, собираются поступать в университет. У каждого из них есть любящая семья, и все, казалось бы, хорошо, но…

    Между ними – препятствие, имеющее отношение уже к современной реальности: она – русская, он – дагестанец. Казалось бы, в чем проблема? Или это и правда тупик?

    Перед зрителями “Соседей” стоит гораздо более сложный вопрос: единственная ли эта проблема и как ее можно решить? В действии может принять участие каждый: можно будет предложить решение проблемы с точки зрения одного из героев и попробовать осуществить его.

    17.11 / 15:00 – 17:00

    ОТКРЫТИЕ ФОТОВЫСТАВКИ “МАЛЫЕ ГОРОДА БОЛЬШОЙ РОССИИ”

    Центр толерантности, вдохновленный идеей Института проблем гражданского общества по поддержке малых городов, организовал выставку фотографий малых городов.

    Цели выставки:

    • Расширить представления о культурном, историческом, географическом, архитектурном богатстве России, рассказать на языке фотографии о малых городах огромной страны, их самобытности, познавательном и рекреационном потенциале;

    • Привлечь внимание широкой общественности, представителей коммерческого и некоммерческого сектора к ресурсам малых городов, повысить туристическую привлекательность регионов и продемонстрировать уникальный образ каждого города;

    • Выявить перспективные идеи для социально значимых проектов и инициатив, направленных на решение проблем территории и повышение качества жизни местного населения.

    17.11 / 15:00 – 17:00

    ПРЕЗЕНТАЦИЯ НОВОЙ ПРОГРАММЫ ЦЕНТРА ТОЛЕРАНТНОСТИ “ОТ СЕРДЦА К СЕРДЦУ”

    Во все времена семья считалась главной человеческой ценностью. Семья – это то, что хочется сохранить, защитить, куда хочется возвращаться. Изменится ли семья в наш век скорости и высоких технологий? Какими будут семьи наших детей и внуков?

    Что бы ни происходило, должно оставаться самое главное: именно в семье люди познают и усваивают важнейшие человеческие ценности.

    Программа “От сердца к сердцу” разработана Центром толерантности совместно с кафедрой психологической антропологии МПГУ. Она создана для широкого распространения в профильных организациях.

    Все заинтересованные организации смогут на безвозмездной основе получить методические разработки и мультимедийный контент для проведения занятий Программы. Условия для этого также будут обозначены на презентации.

    17.11 / 15:00 – 17:00

    18 ноября

    КРУГЛЫЙ СТОЛ ПО СЕТЕВОМУ ВЗАИМОДЕЙСТВИЮ СОЦИАЛЬНО ОРИЕНТИРОВАННЫХ НКО И ГБОУ В ОБЛАСТИ ГРАЖДАНСКОГО ВОСПИТАНИЯ МОЛОДЕЖИ В УСЛОВИЯХ РЕФОРМЫ СИСТЕМЫ ОБРАЗОВАНИЯ

    В рамках мероприятия состоится знакомство представителей системы образования и СоНКО Москвы, деятельность которых направлена на гражданское воспитание молодежи.

    Представители двух систем смогут подробнее узнать о текущей и планируемой работе друг друга, определить имеющиеся ресурсы, исследовать возможность совместного движения к цели и разработать стратегию сотрудничества.

    Мероприятие проводится совместно с Московским домом национальностей.

    18.11 / 15:00 – 18:00

    19 ноября

    КРУГЛЫЙ СТОЛ ПО АКТУАЛЬНЫМ ВОПРОСАМ ПСИХОЛОГО-ПЕДАГОГИЧЕСКИХ МЕТОДОВ ПРОФИЛАКТИКИ ЭКСТРЕМИЗМА В МОЛОДЕЖНОЙ СРЕДЕ

    Цель цикла научно-методических семинаров, частью которого будет данный круглый стол – содействие повышению эффективности работы образовательных организаций в области профилактики ксенофобии и экстремизма. Данная тема является крайне актуальной для современного психологического сообщества.

    Задачи:

    • Расширить спектр используемых форм и методов работы в заявленной области;

    • Повысить компетентность педагогов в области причин и предпосылок вовлечения молодежи в экстремистские организации и действия;

    • Обучить сотрудников образовательных организаций методам профилактической работы с молодежью.

    Формы участия:

    • Участие в дискуссиях и тематических мастерских;

    • Постерная презентация программ и мероприятий по профилактике экстремизма;

    • Проведение мини-мастерских по обмену опытом психолого-педагогической работы в сфере профилактики молодежного экстремизма.

    19.11 / 15:00 – 18:00

    20 ноября

    МУЗЫКАЛЬНЫЙ МАСТЕР-КЛАСС АВГУСТИНА ГРИШИНА “ЗВУКИ ГОРОДА”

    Мастер-класс предлагает заглянуть в мир традиций разных народов, живущих в Москве, через привычный и значимый фон жизни каждого человека – музыку. Ведущий семинара – этнограф, музыкант и путешественник Августин Гришин, создатель группы “Длина дыхания”.

    Участники мастер-класса смогут попробовать поиграть на инструментах разных культур, узнать об их историческом различии и обсудить трансформацию в современности, тем самым почувствовав себя одной из составляющих этнического многообразия столицы.

    Мастер-классы Августина Гришина – уже традиционное яркое завершение Недели толерантности.

    20.11 / 13:00 – 15:00

    Вход на все мероприятия Недели толерантности свободный, по предварительной РЕГИСТРАЦИИ одним из способов:

    • на сайте музея

    • по телефону 8 (495) 645-05-50 доб. 220

    • по электронной почте [email protected]

    КОЛИЧЕСТВО МЕСТ ОГРАНИЧЕНО!

    Необходимо быть внимательными при выборе мероприятия и обращать внимание на предполагаемую целевую аудиторию.

    Адрес: ул. Образцова, 11, стр. 1А.

    Телефон: +7 495 645-05-50.

    E-mail: [email protected]

    www.jewish-museum.ru.

    Оставить комментарий

    Читайте также

    Проблемы ЛГБТ в Беларуси: можно ли узаконить толерантность? | Беларусь: взгляд из Европы — спецпроект DW | DW

    Участники прошедшей в четверг, 28 сентября, в Минске национальной консультации гражданского общества по противодействию языку вражды и дискриминации в Беларуси пришли к выводу о необходимости принять антидискриминационный закон, который защитил бы все социально уязвимые группы. О том, что только такой закон может изменить отношение белорусов к ЛГБТ-сообществу, а также соответствующую правоприменительную практику, шла речь на презентации результатов исследования «Язык вражды, направленный на ЛГБТ-сообщество». Его провела инициативная группа «Журналисты за толерантность» при поддержке правозащитной организации Article 19 в рамках проекта, объединившего Беларусь, Украину, Молдову, Россию и Кыргызстан.

    Авторы исследования констатировали, что проявление языка вражды против ЛГБТ в СМИ и в публичных выступлениях в подавляющем большинстве случаев не вызывает реакции со стороны властей РБ. Как сказано в докладе, за последние три года уровень использования языка вражды по признаку гендерной идентичности и сексуальной ориентации в Беларуси несколько снизился, но есть опасения, что позитивная тенденция сменится на противоположную, если не закрепить ее правозащитной кампанией. Пока же неизвестно ни об одном случае привлечения к уголовной ответственности в Беларуси лиц, допустивших разжигание вражды по отношению к ЛГБТ-сообществу.

    Дискриминация ЛГБТ есть, а судебной практики нет

    Оценивать масштаб проблемы дискриминации ЛГБТ в Беларуси сложно, потому что люди просто не знают, что это такое: нет ни определений, ни механизмов, признает глава Белорусского Хельсинкского комитета (БХК) Олег Гулак. Нельзя судить о ней и по судебной практике. «Нет законодательства, люди не видят, как этим можно воспользоваться, нет этих дел, нет обращений», — сетует Гулак.

    Олег Гулак

    А пока такая судебная практика отсутствует, дискриминация ЛГБТ, по мнению правозащитников, остается в Беларуси повседневной реальностью. Ненасильственные проявления гомо- и трансгендерфобии, по данным координатора правозащитной программы «Идентичность и право» Натальи Маньковской, заметны в первую очередь на рынке труда. Особенно от этого страдают трансгендеры. В Беларуси нет никакой защиты частной жизни таких лиц. Учитывая крайне негативное отношение белорусского общества к трансгендерам, эти люди порой оказываются иногда просто без работы и средств к существованию.

    По словам Маньковской, лишь в 15% случаев преступники привлекаются к ответственности, когда жертва выбирается ими только по признаку ее сексуальной ориентации. «В остальных случаях или жертва боится обращаться в милицию, или милиция не слишком заинтересована в том, чтобы искать нападавших. Бывает, что следователи давят на потерпевших, чтобы они помирились с обвиняемыми», — добавляет правозащитница.

    Туманное белорусское законодательство

    Закона, аналогичного российскому о запрете пропаганды нетрадиционных сексуальных отношений среди несовершеннолетних, в Беларуси нет. Но нет и закона, защищающего представителей ЛГБТ-сообщества. Положения о недопустимости дискриминации по отдельным признакам закреплены в разных нормативных актах. Однако в перечне таких признаков не идет речь о сексуальной ориентации и (или) гендерной идентичности.

    Наталья Маньковская

    Как сообщила DW Наталья Маньковская, с 1 июля 2017 года в Беларуси вступили в силу поправки в ряд законов, направленные на «защиту детей от информации, представляющей вред их здоровью и развитию». В них, поясняет Маньковская, нет таких формулировок, которые содержатся в вышеназванном законе РФ, но есть упоминание о «дискредитации семейных отношений».

    То есть, продолжает Маньковская, среди лиц моложе 18 лет запрещена к распространению информация, «дискредитирующая институт семьи и брачно-семейные отношения». При этом законодатели не уточнили, что именно они имели в виду, используя такую достаточно туманную формулировку. И пока нельзя утверждать, что ее «хотят использовать, чтобы заткнуть рот активистам ЛГБТ-движения».

    Защитить права уязвимых групп, не допустив цензуры

    Йоанна Шиманска, координатор программ Article 19, указывает на сложность самой темы, связанной с языком вражды, который используют, в том числе и в Беларуси, в отношении ЛГБТ-сообщества. Ответом на него, по мнению Шиманской, не должны быть одни лишь запреты.

    Цензура, считает она, не метод, это плохо работает и может дать противоположный результат: «Мы пытаемся противодействовать языку вражды, одновременно не ограничивая свободу слова. О языке ненависти уместно говорить, когда есть преднамеренное подстрекательство к насилию, к дискриминации».

    Сложность ситуации в Беларуси состоит еще и в том, отмечает Олег Гулак, что проблема дискриминации уязвимых групп не является проблемой для большинства, и для реального равенства нужны дополнительные меры, чтобы такие социальные группы были услышаны. Гулак считает целесообразным обратиться к опыту европейских стран. В Беларуси, по его словам, сегодня не хватает инструментов для эффективной защиты и восстановления нарушенных прав, реального продвижения равенства.

    Гулак уверен, что «необходимо комплексное антидискриминационное законодательство, предусматривающее и понятийный аппарат, и специальные меры и инструменты, которые могли бы использоваться эффективно. Кроме того, нужна структура для продвижения идеи развития равенства и недискриминации».

    По результатам состоявшихся консультации, рассказывает участник инициативы «Журналисты за толерантность» Олег Рожков, было решено разработать простые предложения по тому, «как противодействовать языку вражды, куда обращаться в случае прямых оскорблений, как воспользоваться законами, которые действуют уже сейчас, но в которых не указано ЛГБТ-собщество как социально уязвимая группа».

    Смотрите также:

    • Немцы и эротика: история отношений

      Моральный переворот

      Сфера сексуальной морали подверглась в ФРГ радикальной трансформации в 1960-е годы. В молодежном журнале Bravo стали открыто обсуждаться проблемы секса, а в кинопрокате появились эротические фильмы. В 1968 году рекорд популярности побила комедия «Сделай это, крошка!», поставленная Май Спилс (на фото — в центре). Главные роли сыграли Уши Глас (Uschi Glas) и Вернер Энке (Werner Enke).

    • Немцы и эротика: история отношений

      Грешница

      А в 1951 году кинофильм «Грешница» с совсем молодой тогда актрисой Хильдегард Кнеф (Hildegard Knef) в главной роли вызвал скандал в ФРГ из-за одной-единственной эротической сцены, невинность которой сегодня вызвала бы только улыбку. Но при консервативном правительстве канцлера Конрада Аденауэра (Konrad Adenauer) такие сцены были просто немыслимы.

    • Немцы и эротика: история отношений

      Контрацепция как залог женской свободы

      Когда в 1961 году фирма Schering стала выпускать противозачаточные таблетки, в ФРГ разразился страшный скандал. Церковь предрекала «моральное разложение молодежи», газеты взахлеб писали о том, что женщины, принимающие подобные медикаменты, становятся нимфоманками. Тем не менее, таблетки пользовались большим спросом, а контрацепция стала залогом женской свободы.

    • Немцы и эротика: история отношений

      Сексуальная революция

      Немецкое молодежной движение в конце 1960-х годов не только пошатнуло политическую систему ФРГ, но и дало толчок сексуальной революции. Первым пристанищем «свободной любви» стало знаменитое западноберлинское сообщество «Коммуна 1», в числе основателей которого были хиппи Райнер Лангханс (Rainer Langhans) и его красавица-подруга Уши Обермайер (Uschi Obermaier).

    • Немцы и эротика: история отношений

      Секс-шопы и каталоги по «гигиене брака»

      В послевоенные годы в ФРГ завоевала известность Беате Узе (Beate Uhse), открывшая первый в мире секс-шоп и основавшая фирму по торговле «эротическими принадлежностями», со временем превратившуюся в целую империю. Ее имя знало 98 процентов взрослого населения страны. Компания Беате Узе также конфиденциально рассылала своим клиентам каталоги товаров по «гигиене брака».

    • Немцы и эротика: история отношений

      «Не гомосексуал извращен…»

      Еще недавно к людям с «нетрадиционной», как принято говорить, сексуальной ориентацией и в Германии относились не слишком толерантно. Кинорежиссер и гей-активист Роза фон Праунхайм (справа) много сделал для того, чтобы это изменилось. Один из его документальных фильмов называется «Не гомосексуал извращен, а ситуация, в которой он живет».

    • Немцы и эротика: история отношений

      Проблема гомофобии

      В Германии гомосексуализм был щекотливой темой. Долгое время политики предпочитали ее не затрагивать. Положения антигомосексуального параграфа 175 в ФРГ смягчили лишь в 1969 году, и однополые связи между мужчинами перестали быть уголовно наказуемы. А в 1994 году закон был и вовсе отменен. При этом в профессиональном спорте, например, гомосексуалы и сегодня не афишируют свою сексуальную ориентацию.

    • Немцы и эротика: история отношений

      Очаровательная Лило Вандерс

      В прошлом году в Бонне прошла выставка, которая рассказывала об изменениях сексуальной морали в ФРГ, ГДР и объединенной Германии. На ее открытии побывала дрэг-квин и телеведущая Лило Вандерс (Lilo Wanders). Этот сценический образ создал актер Эрни Райнхард (Ernie Reinhardt), давно ставший в Германии культовой фигурой.

      Автор: Хайке Мунд, Наталия Королева


    бесплатных тем для слайдов Google Slides и шаблонов PowerPoint

    Freemium Нравиться

    Культурное разнообразие

    Нацельтесь на международную аудиторию, проведя презентацию о культурном разнообразии с помощью нового бесплатного шаблона, который может предложить Slidesgo. Его красивый дизайн слайдов и универсальность позволяют легко увлечь всех, вызывая улыбку на их лицах.

    Freemium Нравиться

    Урок прав человека

    Есть ряд норм, которые являются фундаментальными, универсальными и, самое главное, эгалитарными.Это не что иное, как права человека, и очень важно, чтобы о них знали все. Подготовьте урок с помощью этого классного шаблона презентации от Slidesgo!

    Премиум Нравиться Скачать

    Премиум шаблон

    Разблокируйте этот шаблон и получите неограниченный доступ

    Тезис о разнообразии

    Признайте и примите нашу индивидуальную уникальность и различия с помощью этой презентации магистерской диссертации по разнообразию. С помощью этого специально разработанного шаблона вы демонстрируете понимание и уважение к различным культурам. Убедитесь сами!

    Freemium Нравиться

    Маркетинговый план некоммерческой компании

    Создание некоммерческих организаций — прекрасный способ оказать поддержку и помощь тем, кто в ней нуждается, и отдать должное обществу.Они могут быть сосредоточены на многих различных дисциплинах, от религии и науки до социальных и семейных. В этом шаблоне есть все элементы, необходимые для продвижения . ..

    Нравиться

    Образец людей

    Вам нужна очень разносторонняя презентация, чтобы говорить о клиентах, демографии, целях, исследованиях рынка или любой связанной теме? Воспользуйтесь этим классным шаблоном прямо сейчас.Мы включили раздел о Международном дне мира и чувств.

    Нравиться

    Предложение по проекту социальной интеграции

    Давайте стремимся к справедливому обществу, в котором ко всем равное отношение! Отредактируйте этот новый шаблон, чтобы представить проектное предложение по социальной интеграции.Его классные иллюстрации из Stories и чистые макеты отлично подойдут. Вы также можете принести эти слайды на урок обществознания. Поддержка …

    Нравиться

    Информационный бюллетень Embrace Diversity

    Информационные бюллетени

    — отличный способ поделиться с людьми новой информацией и объявлениями.Как насчет использования нашего шаблона для создания шаблона, в котором вы принимаете разнообразие, как следует из его названия? Помимо полезных макетов и разделов, здесь довольно много иллюстраций людей и квадратных форм.

    Нравиться

    Равенство и основные права

    Давайте бороться за более равноправное общество, в котором соблюдаются основные права! Вот наш подход: шаблон презентации, полностью редактируемый и полный иллюстраций самых разных людей, позволяющий позиционировать себя в пользу разнообразия.Эти слайды структурированы так, что вы можете использовать их для проекта …

    Премиум Нравиться Скачать

    Премиум шаблон

    Разблокируйте этот шаблон и получите неограниченный доступ

    Международный день счастья

    Знаете ли вы, что есть Международный день счастья? Да, есть! Отмечается ежегодно 20 марта, начиная с 2013 года.Быть счастливым — одна из главных целей человека, и на нее влияет множество факторов. Например, знаете ли вы …

    Премиум Нравиться Скачать

    Премиум шаблон

    Разблокируйте этот шаблон и получите неограниченный доступ

    Пограничное расстройство личности

    Пограничное расстройство личности влияет на то, как человек думает и чувствует себя и других.С помощью этой презентации вы сможете объяснить особенности этого психического заболевания, придав ему интересный оттенок благодаря карикатурным иллюстрациям. Дизайн абстрактный, в синем цвете и с волнами. Внутри шаблона вы …

    Премиум Нравиться Скачать

    Премиум шаблон

    Разблокируйте этот шаблон и получите неограниченный доступ

    Охватывая нашу культуру Профиль компании

    Работа в фирме, идущей в ногу со временем, современной и предполагающей разнообразие, имеет множество преимуществ.Поделитесь профилем своей компании и докажите, почему ваш бизнес — один из лучших. Есть геометрический дизайн, который полностью раскрывает творческий потенциал. Фоны светло-голубые и имеют …

    Премиум Нравиться Скачать

    Премиум шаблон

    Разблокируйте этот шаблон и получите неограниченный доступ

    Признательность в приемной семье

    Приемные семьи играют важную роль в развитии детей, улучшении их жизни.Вот почему с 1988 года май объявлен Национальным месяцем патронатного воспитания в Соединенных Штатах, и они пользуются этим днем, чтобы выразить им признательность. Если вы хотите присоединиться, мы предлагаем этот шаблон …

    Нравиться

    Урок разнообразия и равенства для средней школы

    Разговор с молодыми людьми о разнообразии и равенстве — лучший способ повысить осведомленность.Поэтому, если вам нужно подготовить урок по этим темам, мы предлагаем этот креативный шаблон с забавными иллюстрациями. Он имеет кремовый фон, на который мы добавили несколько красочных элементов, символизирующих разнообразие. Кроме того, …

    Нравиться

    Расизм должен прекратиться

    Ответственность за борьбу с расизмом лежит на каждом человеке.Для этого самое важное — с детства воспитывать уважение ко всем людям, независимо от цвета их кожи, пола, религии и т. Д. С помощью этого информационного бюллетеня вы можете помочь повысить осведомленность об этой проблеме. Он имеет элегантный коричневый дизайн и …

    Пост в Instagram

    Нравиться

    Счастливые и открытые пары для социальных сетей

    Инклюзивный контент о парах для социальных сетей становится все более востребованным.И этот маркетинговый шаблон с форматом поста в Instagram полон таких изображений. Если вы хотите показать своим подписчикам изображения пар, которые не соответствуют классическим архетипам из-за расы, пола и других факторов, …

    Нравиться

    Красивая тема интимного коллажа для маркетинга

    Красота субъективна.Для нас все равны, независимо от ваших убеждений, национальности или пола. Этот новый шаблон, созданный для маркетинговых презентаций, предлагает очень инклюзивную перспективу. Почувствуйте себя хорошо (и расскажите об этом своей аудитории) с помощью этих простых слайдов, главной особенностью которых является использование фотографий в …

    Нравиться

    Общественный центр

    Есть ли в вашем городе общественный центр, место, где люди могут общаться и собираться вместе? Такой шаблон может подойти для презентации, в которой вы предоставляете некоторую информацию о мероприятиях или встречах в этом месте.Мы использовали геометрические фигуры с цветовыми градиентами …

    Нравиться

    День уважения к культурному разнообразию

    День уважения культурного разнообразия проходит 12 октября, и Аргентина — одна из стран, где празднование важнее! В U.S, например, этот день называется Днем Колумба и празднует прибытие Христофора Колумба в Америку в 1492 году. Объяснение …

    Презентация собственного пептида для индукции толерантности CD4 + Т-клеток in vivo регулируется фактором процессинга, который отображается в области класса II локуса главного комплекса гистосовместимости

    Собственные белки регулярно обрабатываются для представления аутореактивным Т-клеткам в ассоциации с молекулами главного комплекса гистосовместимости (MHC) как класса I, так и класса II.Презентация собственных пептидов играет решающую роль в приобретении репертуара Т-клеток во время отбора тимуса. Ранее мы сообщали, что собственный пептид MHC класса I Ld 61-80 был иммуногенным у сингенных мышей B10.A (H-2a). Мы показали, что, несмотря на его высокое сродство к собственным молекулам MHC класса II, пептид Ld 61-80 не смог вызвать элиминацию аутореактивных CD4 + Т-клеток, предположительно из-за неполного процессинга и презентации в тимусе, развивающемся в B10.A (скрытый самопептид). . В этом отчете мы показали, что скрытый фенотип не является внутренним свойством собственного пептида Ld 61-80, поскольку было обнаружено, что он естественно представлен и впоследствии является толерогенным у мышей BALB / c (H-2d) (доминантный собственный пептид ).Кроме того, было обнаружено, что самопептид Ld 61-80 является иммуногенным у разных мышей H-2a, тогда как он неизменно является толерогенным у мышей H-2d независимо от их фоновых генов. Мы наблюдали, что Ld 61-80 одинаково хорошо связывается с молекулами H-2d и H-2k MHC класса II. Также не было обнаружено корреляции между количеством собственного белка Ld и толерогенностью Ld 61-80. Неожиданно Ld 61-80 не был представлен в природе у мышей (H-2d x H-2a) F1, что указывает на то, что локус H-2a MHC содержит ген, который нарушает представление собственного пептида.Анализ ответов Т-клеток на самопептид у нескольких рекомбинантных мышей H-2 показал, что презентация Ld 61-80 контролируется генами, которые картированы в 170 т.п.н. части области MHC класса II. Это исследование показывает, что (а) эндогенно процессируемые самопептиды, представленные молекулами MHC класса II, участвуют в формировании репертуара CD4 + Т-клеток в тимусе; (b) На выбор самопептидов для презентации молекулами MHC класса II растущим аутореактивным Т-клеткам влияют неструктурные гены MHC, которые картируются в 170 т.п.н. части области MHC класса II; и (c) локус MHC мышей H-2a кодирует факторы, которые предотвращают или отменяют презентацию молекулами MHC класса II собственного пептида Ld 61-80.Эти находки могут иметь важное значение для понимания молекулярных механизмов, участвующих в приобретении репертуара Т-клеток и индукции самотолерантности.

    Как удалить фон с изображения

    На днях я работал над презентацией.

    Я пытался придумать способ добавить логотип и несколько значков в PowerPoint, но возникла проблема. У всех изображений был разный цвет фона, и мне нужно, чтобы все они выглядели одинаково.

    Может быть, вы тоже были там. У вас есть логотип, значок или другое изображение, с помощью которого вы пытаетесь создать дизайн, но вам нужно удалить фон изображения. Возможно, вам потребуется добавить логотип вашей компании к новому изображению или добавить значок в презентацию PowerPoint.

    Вы можете сделать фон изображения прозрачным с помощью продвинутого фоторедактора, такого как Photoshop, TechSmith Snagit или множества других инструментов.

    К счастью, подход одинаков, независимо от того, какой инструмент вы используете.С Snagit достаточно всего нескольких шагов, чтобы быстро удалить фон с вашего изображения.

    Как сделать фон изображения прозрачным

    Имейте в виду, что Snagit не так сложен, как профессиональная программа редактирования, такая как Photoshop, и может не работать, чтобы удалить фон с фотографии или изображения со сложным фоном.

    Однако Snagit — прекрасная альтернатива Photoshop, позволяющая сделать изображение прозрачным, если вы не знакомы с высококлассными инструментами.

    Бесплатная пробная версия: Вы можете попробовать Snagit бесплатно. Получите все необходимое для захвата и редактирования изображений на Windows или Mac.

    Шаг 1: Вставьте изображение в редактор

    Начните со снимка экрана с помощью Snagit или загрузите изображение из меню «Файл». Лучше всего подходят изображения с белым фоном, сплошным цветом или высококонтрастным фоном.

    Шаг 2. Затем нажмите кнопку «Заливка» на панели инструментов и выберите «Прозрачный

    ».

    Если вам впервые нужно добавить прозрачную заливку в быстрые стили, это довольно просто.Все, что вам нужно, это нажать на опцию цвета заливки в свойствах инструмента и выбрать прозрачную заливку.

    Шаг 3. Отрегулируйте допуск

    Довольно легко настроить допуск на этом изображении, потому что оно только черно-белое. Но иногда получается изображение с множеством разных оттенков. Если у вас есть изображение с множеством похожих цветов или градиентов на заднем плане, вы можете получить некоторое кровотечение вокруг значка, логотипа и т. Д.


    Единственное, что вы можете сделать, чтобы исправить, — это отрегулировать допуск заполнения.Один процент — самый строгий, а 100 процентов означает, что он в значительной степени размывает все ваше изображение. Возможно, вам придется поиграть с допуском, чтобы получить правильный уровень прозрачности.

    Регулировка непрозрачности определяет, насколько прозрачной должна быть заливка. Чем непрозрачнее, тем менее прозрачна ваша заливка. Так что, если вы хотите полностью удалить фон, используйте 0%.

    Шаг 4: Щелкните области фона, которые вы хотите удалить

    Если вы используете снимок экрана или изображение PNG, по умолчанию будет прозрачный фон.Если вы используете JPG или другой формат файла, вам нужно сначала настроить цвет фона в редакторе Snagit, иначе он будет по умолчанию белым, а не прозрачным.

    Для этого просто нажмите Изображение> Цвет холста (в Windows) или Изображение> Изменить цвет холста… (в Mac).

    Шаг 5. Сохраните изображение как PNG

    Если вы не сохраните изображение как файл PNG, по умолчанию будет выбран белый фон.

    И это все, что нужно для удаления фона с изображения.Это займет всего несколько шагов и дает вам свободу создавать плавный вид для ваших учебных документов, маркетинговых материалов или презентаций.

    Бесплатная пробная версия: Вы можете попробовать Snagit бесплатно. Получите все необходимое для захвата и редактирования изображений на Windows или Mac.

    Непереносимость лактозы у детей: история вопроса, патофизиология, эпидемиология

    Автор

    Стефано Гуандалини, доктор медицины Основатель и медицинский директор Центра глютеновых болезней, руководитель отдела детской гастроэнтерологии, гепатологии и питания, Департамент педиатрии, Медицинский центр Чикагского университета; Профессор кафедры педиатрии, отделение гастроэнтерологии, гепатологии и питания, Отделение биологических наук Чикагского университета, Медицинская школа Притцкера

    Стефано Гуандалини, доктор медицины, является членом следующих медицинских обществ: Американская гастроэнтерологическая ассоциация, Европейское общество Детская гастроэнтерология, гепатология и питание, Североамериканское общество детской гастроэнтерологии, гепатологии и питания, Североамериканское общество по изучению целиакии

    Раскрытие: Ничего не разглашать.

    Соавтор (ы)

    Ричард Э. Фрай, доктор медицины, доктор философии Профессор детского здоровья, Медицинский колледж Университета Аризоны в Фениксе; Заведующий отделением нервно-психических расстройств, директор программ по аутизму и синдрому Дауна и хрупкой Х-хромосоме, Отделение неврологических расстройств, Отделение неврологии, Неврологический институт Барроу Детской больницы Феникса

    Ричард Э. Фрай, доктор медицинских наук, является членом следующих медицинских обществ: Американская академия неврологии, Американская академия педиатрии, Общество детской неврологии

    Раскрытие информации: нечего раскрывать.

    Делия М. Ривера, доктор медицины Доцент кафедры педиатрии, отделение инфекционных заболеваний и иммунологии, Медицинская школа Леонарда Миллера Университета Майами

    Делия М. Ривера, доктор медицины, является членом следующих медицинских обществ: Американской академии наук Педиатрия, Американское общество микробиологии, Общество педиатрических инфекционных болезней

    Раскрытие: Ничего не разглашать.

    Стивен М. Боровиц, доктор медицины Профессор педиатрии и наук об общественном здравоохранении, Департамент педиатрии, Отделение детской гастроэнтерологии, гепатологии и питания, Медицинская школа Университета Вирджинии

    Стивен М. Боровиц, доктор медицины, является членом следующих медицинских организаций: общества: Американская академия педиатрии, Американская гастроэнтерологическая ассоциация, Американское педиатрическое общество, Североамериканское общество детской гастроэнтерологии, гепатологии и питания, Общество педиатрических исследований

    Раскрытие: Ничего не разглашать.

    Специальная редакционная коллегия

    Мэри Л. Виндл, PharmD Адъюнкт-профессор, Фармацевтический колледж Медицинского центра Университета Небраски; Главный редактор Medscape Drug Reference

    Раскрытие информации: нечего раскрывать.

    B UK Li, MD Профессор педиатрии, отделение гастроэнтерологии, гепатологии и питания, Медицинский колледж Висконсина; Лечащий гастроэнтеролог, директор программы циклической рвоты, Детская больница Висконсина

    B Великобритания Ли, доктор медицинских наук, является членом следующих медицинских обществ: Alpha Omega Alpha, Американская гастроэнтерологическая ассоциация, Североамериканское общество детской гастроэнтерологии, гепатологии и питания

    Раскрытие информации : Нечего раскрывать.

    Главный редактор

    Кармен Каффари, доктор медицины Доцент кафедры педиатрии, отделение гастроэнтерологии и питания, Медицинская школа университета Джона Хопкинса

    Кармен Каффари, доктор медицины, является членом следующих медицинских обществ: Американский колледж гастроэнтерологии, Американская гастроэнтерологическая ассоциация, Североамериканское общество детской гастроэнтерологии, гепатологии и питания, Королевский колледж врачей и хирургов Канады

    Раскрытие информации: получил гонорары от лабораторий Прометея за выступления и обучение; Получал гонорары от Abbott Nutritionals за выступления и преподавание.для: Abbott Nutritional, Abbvie, спикеры.

    Дополнительные участники

    Эрик С. Маллер, MD

    Эрик С. Маллер, доктор медицины, является членом следующих медицинских обществ: Американской ассоциации по изучению заболеваний печени, Американской гастроэнтерологической ассоциации, Американского общества хирургов-трансплантологов, Североамериканского общества детской гастроэнтерологии, Гепатология и питание

    Раскрытие информации: не раскрывать.

    (PDF) Обучение уважению и толерантности с презентациями о культурных ценностях

    Международный журнал социальных наук и образовательных исследований

    ISSN 2520-0968 (онлайн), ISSN 2409-1294 (печать), июнь 2017 г., том.3, № 4

    2. Культурные презентации для развития толерантности

    Требовалось вмешательство. Отношение учеников друг к другу повлияло на атмосферу в классе

    , и учить их стало очень сложно. Я предложил своим ученикам сделать презентации

    своим друзьям об их культурных ценностях. Класс был рад познакомить других со своей культурой.

    Каждый день один студент рассказывал о своей культуре.Ведущие даже были одеты в традиционную одежду

    и показывали по телевидению короткометражные фильмы о своей культуре. Каждый студент потратил 20

    минут. Вначале некоторые студенты пытались подразнить выступающих, и иногда было сложно их контролировать. Однако после нескольких презентаций они, похоже, с нетерпением ждали еще

    презентаций. Они начали открываться для понимания того, что презентации были полезны для них

    , чтобы расширить их кругозор.Я побуждал их задавать вопросы докладчикам, чтобы узнать

    больше о других культурах.

    Толерантность должна воспитывать студентов, чтобы они могли функционировать в различных обществах (Vogt, 1994). В

    современных разнообразных обществах люди должны уважать друг друга и развивать взаимопонимание. В

    создании толерантного общества необходимо развивать межобщинные отношения. Я обнаружил, что культурные презентации

    способствовали укреплению уважения к разнообразию в классе.Студенты были привержены проекту

    и приложили много усилий для своих презентаций. Влаху (1997) объясняет, что

    учителя несут ответственность не только за выполнение учебной программы, но и за этику уважения и терпимости, которые способствуют повышению качества обучения учащихся. Во время презентаций студенты притихли. Они

    узнавали друг друга, и они начали принимать разнообразие.

    Толерантность — фундаментальная ценность, объединяющая людей.Когда люди нетерпимы к чужим

    идеям, сплоченность сообщества не может быть достигнута. Хотя студенты не пришли к согласию с

    , во что верят другие, у них не было отрицательных оценок друг друга после презентаций

    . Часто учителя избегают обсуждения спорных вопросов в классе, потому что они опасаются, что будет трудно контролировать класс (McNeil, 1986). Однако для интеллектуального и духовного развития учеников это необходимо.Взаимодействие в классе может достигаться

    , если люди терпят и уважают друг друга.

    Людям необходимо научиться жить в разнообразии (Vogt, 1994). Если люди не могут обсудить идеи, чтобы найти общую основу

    , возникает конфликт. По этой причине изучение различий между людьми позволяет людям

    распознавать разнообразие ценностей и культур. Передача информации о культурных различиях

    посредством презентаций помогла студентам развить терпимость и уважение ко всем традициям.Я считаю, что этот проект

    вдохновил меня на обучение. В этих презентациях я пытался показать своим ученикам, что все люди

    равны. По мере того, как они узнавали больше о культурах других, они становились более тесными.

    Основная цель образования — научить студентов толерантности (Grover, 2007). Колесанте и Биггс

    (1999) утверждают, что школы могут помочь учащимся развивать терпимость. Включение культурных ценностей в учебную программу

    дало положительные результаты.В презентациях преподавались фундаментальные концепции уважения и толерантности

    . Студенты имели возможность узнать о своих обязанностях перед сообществом

    . Включение преподавания культурных ценностей в школьные предметы в целях поощрения всеобщего уважения

    научило учащихся жить ответственно как граждане мира. Подчеркивается, что климат

    TSCOT + чувствительная толерантность к CD4, опосредованная эпителиальными клетками тимуса, по прямой презентации

    Abstract

    Хотя много усилий было направлено на изучение механизмов центральной толерантности, роль стромальных клеток тимуса остается неуловимой.Чтобы дополнительно охарактеризовать это событие, мы разработали модель на мышах, ограничивающую LacZ стромальным котранспортером тимуса (TSCOT), экспрессирующими стромальные клетки тимуса (TDLacZ). Тимус этой мыши содержит приблизительно 4300 клеток TSCOT + , каждая из которых экспрессирует несколько тысяч молекул антигена LacZ. Клетки TSCOT + экспрессируют кортикальный маркер CDR1, CD40, CD80, CD54 и главный комплекс гистосовместимости класса II (MHCII). При изучении эндогенных ответов, направленных против LacZ, мы наблюдали значительную толерантность.Об этом свидетельствует разнообразный репертуар Т-клеток, измеренный как анализом пролиферации Т-лимфоцитов CD4, так и анализом антиген-специфических изотипов антител. Этот процесс толерантности был, по крайней мере, частично независимым от экспрессии гена аутоиммунного регулирующего элемента . Когда мышей TDLacZ скрещивали с новым рецептором Т-клеток CD4 (TCR), трансгенным реактивным против LacZ (BgII), произошла полная делеция дважды положительных тимоцитов. Культура реаггрегата тимуса плода обедненных CD45 и UEA стромальных клеток тимуса из TDLacZ и отсортированных тимоцитов, несущих TCR, исключила возможность перекрестной презентации дендритными клетками тимуса и медуллярными эпителиальными клетками для делеции.В целом, эти результаты демонстрируют, что введение неоантигена в клетки, экспрессирующие TSCOT, может эффективно устанавливать полную толерантность и предлагать возможное применение для делеции антиген-специфических Т-клеток путем введения антигена в клетки TSCOT + .

    Сведения об авторе

    Т-клетки играют решающую роль в иммунном ответе. Развиваясь в тимусе (откуда Т-клетки и их предшественники, тимоциты, получили свое название), тимоциты отбираются по способности распознавать вредный антиген (положительный отбор), в то время как те, которые реагируют на антигены, присутствующие в их собственном организме, удаляются ( отрицательный выбор).Догма утверждает, что тимус разделен на различные функциональные части, чтобы гарантировать, что эти контрастные процессы отбора происходят эффективно: считается, что кора головного мозга отвечает за положительный отбор, а мозговое вещество — за отрицательный. В этом исследовании мы использовали новую трансгенную мышь (несущую маркер LacZ в небольшой фракции клеток коры), чтобы проверить, действительно ли кора головного мозга исключена из отрицательного отбора. Мы смогли показать, что введенный «антиген» LacZ, присутствующий только в корковых клетках, приводит к тому, что они устраняют любые LacZ-реактивные Т-клетки из иммунного репертуара и приводит к толерантности иммунной системы организма к «антигену» LacZ.Этот процесс очень эффективен, так что относительно небольшое количество молекул антигена, присутствующих в небольшой части клеток коры тимуса, может выполнять проверку всех развивающихся тимоцитов.

    Образец цитирования: Ahn S, Lee G, Yang SJ, Lee D, Lee S, Shin HS, et al. (2008) TSCOT + Чувствительная толерантность к CD4, опосредованная эпителиальными клетками тимуса, при прямом представлении. PLoS Biol 6 (8): e191. https://doi.org/10.1371/journal.pbio.0060191

    Академический редактор: Авинаш Бхандула, Пенсильванский университет, Соединенные Штаты Америки

    Поступила: 4 сентября 2007 г .; Одобрена: 23 июня 2008 г .; Опубликовано: 5 августа 2008 г.

    Это статья в открытом доступе, распространяемая в соответствии с положениями декларации Creative Commons Public Domain, которая предусматривает, что после размещения в общественном достоянии эта работа может свободно воспроизводиться, распространяться, передаваться. , модифицированы, созданы на основе или иным образом использованы кем-либо в законных целях.

    Финансирование: Эта работа была поддержана грантом Molecular and Cellular BioDiscovery Research Program 34689–1 Министерства науки и технологий и грантом Корейского исследовательского фонда, финансируемым правительством Кореи (MOEHRD, Фонд содействия фундаментальным исследованиям) ( КРФ-2006-34673-1).

    Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

    Сокращения: БТР, антигенпрезентирующая клетка; cTEC, кортикальная эпителиальная клетка тимуса; ОКРУГ КОЛУМБИЯ, дендритная клетка; DN, двойной отрицательный; DP, двойной положительный; E, эмбриональный день; mAb, моноклональное антитело; MHC, главный комплекс гистосовместимости; mTEC, медуллярная эпителиальная клетка тимуса; RTOC, повторно агрегировать культуру органов тимуса; TDLacZ, котранспортер стромы тимуса delta LacZ; TCR, Рецептор Т-клеток; ТИК, эпителиальная клетка тимуса; TSCOT, котранспортер стромы тимуса; β-гал, β-галактозидаза

    Введение

    Т-клеточная толерантность устанавливается в основном в тимусе, где популяция Т-клеток развивается и обучается с помощью процесса, называемого негативным отбором, чтобы избежать вредной реактивности против аутоантигенов, экспрессируемых в этом тимусе (обзор в [1,2]).На периферии органоспецифическая толерантность может быть установлена ​​с помощью различных других механизмов, включая анергию [3], невежество [4] и регуляторные Т-клетки [5]. Кроме того, антигенпрезентирующие клетки (APC), лишенные костимулирующих молекул в периферических тканях, инициируют абортивные иммунные ответы [6].

    Микроокружение тимуса организовано и оборудовано для достижения эффективной самотолерантности путем предоставления стимулирующих сигналов развивающимся самореактивным тимоцитам. Для разнообразного репертуара Т-клеток этот процесс негативного отбора происходит в основном в медуллярном отделе тимуса (см. Обзор [7,8]).Основным игроком среди гемопоэтических клеток является дендритная клетка (ДК), которая обладает высокоэффективной способностью презентации антигена. Кроме того, широко распространено мнение, что медуллярные эпителиальные клетки тимуса (mTEC), которые беспорядочно / эктопически экспрессируют низкие уровни тканеспецифических периферических антигенов [9,10], также могут инициировать клональную делецию. Открытие гена AIRE и его экспрессии в mTEC привело к пониманию его важной регуляторной роли в удалении аутореактивных Т-клеток, особенно против тканеспецифических антигенов, экспрессируемых в эндокринной системе (обзор [11,12]) .Однако AIRE также экспрессируется в не-mTEC, включая DC тимуса [13,14] и в кортикальных эпителиальных клетках тимуса (cTEC) тимуса с дефицитом Rag-2 [15]. Кроме того, путь перекрестной презентации может участвовать в толерантности CD4 и CD8 к мембраносвязанным антигенам [16]. Следовательно, природа типов клеток, ответственных за индукцию толерантности, все еще остается нерешенной.

    Роль кортикального эпителия в индукции толерантности противоречива (см. Обзор [17–20]). Несколько экспериментов с трансплантацией тимуса ясно показали, что эпителий тимуса обладает толерантной функцией [21-24].Напротив, эксперименты с использованием трансгенных мышей с направлением молекул главного комплекса гистосовместимости класса II (MHCII) [25] или MHCI [26] в кортикальный компартмент тимуса (и кожу) с использованием случайного промотора кератина 14 привели к выводу, что cTEC являются не способен вызвать толерантность. Такие результаты породили идею о том, что микроокружение тимуса разделено на части, причем положительный отбор имеет место в коре головного мозга, а отрицательный — в мозговом веществе. Если это истинная догма, будут аутоиммунные ответы на антигены, специфически экспрессируемые в корковых эпителиальных клетках.Однако, когда другие антигены были нацелены на cTEC с использованием того же промотора, наблюдалась неполная, но значимая толерантность к специфическим антигенам [27,28]. В случае циркулирующего антигена (C5) все типы APC тимуса, включая cTEC, могут влиять на эффективный отрицательный отбор in vitro [29]. Наконец, был поднят вопрос о роли циркулирующих периферических DC в индукции толерантности к тимусу [30] и подтвердился [31].

    Эксперименты относительно способности cTEC эффективно презентировать антигены также были противоречивыми.В ранних исследованиях смерть кортикальных тимоцитов при активации антителом или пептидами интерпретировалась как результат презентации антигена кортикальными стромальными клетками [32,33]. Кроме того, исследование очищенных APC тимуса показало, что cTEC способны представлять антигены самореактивной гибридоме с эффективностью, сравнимой с эффективностью DC тимуса [34]. Однако более поздние исследования показали, что линия клеток со свойствами cTEC неэффективна в процессинге антигенов как in vitro, так и in vivo [35,36].Напротив, Фолькманн и его коллеги, используя обогащенные препараты стромальных клеток из тимуса взрослых, продемонстрировали, что cTEC способны презентовать растворимые антигены так же эффективно, как DC или mTEC в повторно агрегированных культурах. Однако во многих, если не во всех, вышеупомянутых исследованиях трудности с интерпретацией все еще сохраняются, в частности, из-за отсутствия достаточного понимания природы определенной исследуемой субпопуляции cTEC, а также чистоты клеток, экспрессирующих специфические антигены, которые использовались в анализах.Совсем недавно Грей и его коллеги сообщили, что четко определенные очищенные cTEC, а также mTEC экспрессируют костимулирующие молекулы и могут стимулировать наивные Т-клетки так же, как дендритные клетки тимуса in vitro [37]. Поэтому мы сочли необходимым переоценить роль субпопуляции cTEC в индукции центральной толерантности, используя другую модельную систему, которая, возможно, лучше подходит для более прямого ответа на вопрос о том, может ли субпопуляция cTEC представлять эндогенные антигены и может ли это привести к удалению тимоцитов.

    Ранее, пытаясь разделить компоненты эпителиальных клеток тимуса (TEC), мы ввели новый маркер (Ly110), названный тимическим стромальным котранспортером (TSCOT), который экспрессируется в конкретной субпопуляции TEC. TSCOT — это предполагаемый 12-трансмембранный белок, расположенный в основном в коре тимуса [38]. TSCOT не экспрессируется ни в каких других тканях, что обнаружено с помощью количественной ПЦР с обратной транскрипцией (ОТ-ПЦР) [39]. Он также не экспрессируется в тимоцитах [38]. TSCOT + стромальные клетки тимуса — это все MHCII + и CDR1 + / 6C3 + , четко определенные кортикальные эпителиальные маркеры [40], с наблюдаемыми вариациями уровней на разных стадиях развития [41].В этом исследовании мы представляем новую модельную систему мышей под названием TSCOT delta LacZ (TDLacZ), которая экспрессирует β-галактозидазу (β-gal) в субпопуляции TEC. Эта модельная система представляет собой новый инструмент для изучения развития и функционирования ТЕС. Во-первых, мы смогли проследить TSCOT-экспрессирующие TEC с помощью анализов активности β-gal или окрашивания антител и проточной цитометрии с использованием моноклональных антител против TSCOT (mAb) [41]. Ферментативная активность LacZ также может быть проанализирована для определения местоположения клеток с высокой степенью чувствительности как в срезах, так и во всем организме, а экспрессия может быть оценена количественным образом.Во-вторых, поскольку белок вырабатывается эндогенным промотором, эта система предназначена для экспрессии нормальных доз неосамоантигена по сравнению с другими конкурирующими клеточными белками. Это контрастирует с некоторыми предыдущими системами нацеливания на корковую экспрессию, в которых молекулы MHC отображались на необычно низких уровнях [19,26]. В-третьих, отсутствие активности промотора TSCOT в периферических тканях предотвращает участие рециркулирующих DCs, которые могут доставлять периферические антигены в тимус и представлять их эктопически.

    Путем нацеливания на белок LacZ в качестве неоантигена в эпителии тимуса, экспрессирующем TSCOT, мы смогли продемонстрировать, что только TSCOT + CDR1 + TEC, без какой-либо помощи со стороны mTEC или DC, может установить делеционную толерантность в AIRE-независимый способ с удивительно высокой эффективностью.

    Результаты

    Модель мыши TDLacZ для экспрессии антигена, специфичной для субпопуляции TEC

    Мы создали новую систему, введя ген LacZ в локус TSCOT между двумя сайтами BamHI (рис. 1A).LacZ был транскрибирован в том же сообщении, что и 5′-часть сообщения TSCOT, а трансляция LacZ облегчена включением последовательности внутреннего сайта входа в рибосомы (IRES) [42]. Нацеливание было подтверждено саузерн-блоттингом (рис. 1В). Нозерн-блоттинг подтвердил, что сообщение LacZ находится в транскрипте слияния с 5′-частью сообщения TSCOT (рис. 1С).

    Рисунок 1. Нацеливание LacZ в локус TSCOT для экспрессии в тимусном эпителии

    (A) Схематическое представление + / + (вверху), целевой конструкции (в центре) и целевого аллеля (внизу).Показаны сайты рестрикции BclI (BclI) и BamHI (B) и расположение кодирующих областей. Зонд (627 п.н.), использованный в Саузерн-блоте, показан жирной линией под целевым аллелем. Положения праймеров для ПЦР-типирования показаны маленькими стрелками.

    (B) Саузерн-блот дайджеста BclI. Аллель + / + составляет 6,5 т.п.н., а целевой аллель — 7,9 т.п.н.

    (C) Нозерн-блоттинг для сообщения слияния TSCOT-LacZ. Датчик (TSCOT, LacZ и GAPDH control) находится вверху слева.

    (D) Общий выход тимоцитов из Δ / Δ, Δ / + и + / +.Показаны средние значения и стандартные отклонения.

    (E) Анализ стромальных клеток тимуса дикого типа и гомозигот. CD45 ворота тимусов 2-недельного возраста показаны для MHCII и UEA-1. Показаны ворота cTEC, mTEC и nonTEC.

    (F и G) активность β-гал в развивающемся тимусе (E11 и E16, соответственно) плодов от Δ / + и + / + однопометников. Окрашивался только целевой тимус (в черных кругах). Эндогенная активность β-галлы была обнаружена в кишечнике обеих мышей.

    (H) Новорожденные тимусы от однопометников Δ / Δ, Δ / + и + / + демонстрируют дозозависимую экспрессию гена.

    https://doi.org/10.1371/journal.pbio.0060191.g001

    У мышей TDLacZ не было обнаружено каких-либо различимых отклонений в отношении структуры тимуса в результате делеции в части TM5-TM12 белка TSCOT. На рисунке 1E мы показываем, что сходные паттерны стромы тимуса у двухнедельной гомозиготы и дикого типа. Небольшая разница в доле популяций стромальных клеток находилась в пределах экспериментальных вариаций.Также не было обнаружено различий в профилях между гетеро- и гомозиготными однопометниками разного возраста (неопубликованные данные). N-концевая часть, включая трансмембранные участки 1–4 белка, все еще оставалась экспрессированной на поверхности клетки, как обнаружено с помощью проточной цитометрии (неопубликованные данные). Единственная очевидная разница была в общем выходе тимоцитов в возрасте 6 недель, который был немного ниже примерно у одной трети гомозигот TDLacZ (рис. 1D). Однако нам не удалось обнаружить воспроизводимых различий в профилях популяции тимоцитов, кроме индивидуальных вариаций.Кроме того, анализ мышей в возрасте 6 месяцев также не выявил значительных различий в восстановлении тимоцитов и основных профилях CD25, CD44, CD4 и CD8 (неопубликованные данные). Когда Tg-мышь с Т-клеточным рецептором (TCR) 5CC7 была скрещена с TDL, не было обнаружено значительных различий для популяций тимоцитов при выборе или невыборке фона (F. Flomerfelt, неопубликованные данные).

    Когда активность β-gal оценивали у мышей TDLacZ на 11-й день эмбриона (E11), то есть в момент, когда начинается органогенез тимуса, LacZ уже экспрессируется в двух отдельных зачатках тимуса, но не экспрессируется у однопометников дикого типа. (Рисунок 1F).Это выражение не обнаружено ни в каких других органах. На ст. E16, когда в тимусе в основном развиваются дважды отрицательные (DN) и дважды положительные (DP) клетки, экспрессия LacZ в тимусе также была очень четкой (рис. 1G). Кроме того, эндогенная активность β-gal проявлялась в кишечнике TDLacZ на E16, как и в контроле дикого типа (неопубликованные данные). Активность β-gal в образцах тимуса новорожденных детенышей TDLacZ показала зависимость от дозы гена (рис. 1H).

    Затем мы локализовали LacZ-экспрессирующие клетки в срезах тимуса.На стадии новорожденного окрашивание антителом против LacZ показало экспрессию в основном в коре тимуса, как и ожидалось (рис. 2А). Когда вилочковая железа полностью созрела (в возрасте 8 недель), активность LacZ была также обнаружена в коре головного мозга (рис. 2В). Это согласуется с нашим предыдущим результатом, согласно которому экспрессия белка TSCOT и мРНК была локализована в коре головного мозга [38]. После тщательного исследования мы иногда обнаруживали, что окрашивание LacZ распространяется на кортикомедуллярное соединение (неопубликованные данные, см. Позже). В попытке более подробно охарактеризовать TSCOT-экспрессирующие клетки в зрелом тимусе, был проведен проточно-цитометрический анализ с использованием TSCOT-специфических mAb.Ранее мы сгруппировали популяции стромальных клеток тимуса по крайней мере в пять различных субпопуляций [43]. Три основных популяции — это cTEC как CDR1 + UEA-1 MHCII hi G8.8 + , mTEC как CDR1 UEA-1 + MHCII hi или MHCII GHCII или MHCII . 8 + , а также неэпителиальная популяция, nonTEC, CDR1 UEA-1 MHCII G8.8 . Как показано на рисунке 2C, 35,6% популяции cTEC (CDR1 + MHCII hi ) экспрессируют TSCOT, тогда как ни одна из популяции mTEC или не TEC не экспрессирует определяемые уровни TSCOT.Хотя все клетки, экспрессирующие TSCOT, были положительными по кортикальному маркеру CDR1 [41], было обнаружено, что фракция клеток TSCOT + CDR1 + экспрессирует UEA-1 (неопубликованные данные и см. Обсуждение). Наконец, мы проверили, экспрессируется ли мРНК TSCOT вместе с мРНК FoxN1 и AIRE (рис. 2D). TSCOT и FoxN1 обнаруживались только в эпителиальном компартменте MHCII + CD45 . Напротив, сообщение AIRE было обнаружено как в эпителиальном, так и в CD45 + MHCII + компартментах, как и ожидалось, что подтверждает предыдущий результат по экспрессии в гематопоэтических стромальных клетках тимуса [13-15].

    Рисунок 2. Клетки, экспрессирующие LacZ и TSCOT в тимусе

    (A) Анализ тимуса с использованием антитела против β-gal у новорожденных от гетерозиготы мыши TDLacZ (Δ / +) и дикого типа (+ / +) . Справа показано окрашивание гематоксилином.

    (B) Активность β-гал в тимусе у 8-недельных гомозиготных «нокаутированных» мышей (Δ / Δ) при 10-кратном увеличении. Обозначены корковые и мозговые области, а граница между окрашенными LacZ и ненапряженными областями искусственно обозначена пунктирной линией для лучшей визуализации.

    (C) Проточно-цитометрический анализ TSCOT-экспрессирующих клеток с использованием маркеров в стромальных клетках CD45 тимуса. Профили кортикального маркера CDR1 и медуллярного маркера UEA-1. Определенные cTEC, mTEC и nonTEC стробируются. Каждая закрытая популяция показана справа как уровни TSCOT и UEA-1. Доли клеток TSCOT + показаны в процентах.

    (D) Сообщение об экспрессии TSCOT, FoxN1, AIRE и GAPDH в отсортированных отделах тимуса в соответствии со статусом CD45 / MHCII с использованием ОТ-ПЦР (30 циклов).Клетки были изолированы либо от новорожденных, либо от тимусов 6-недельного возраста, и маркеры клеточной поверхности, используемые для сортировки, показаны вверху.

    https://doi.org/10.1371/journal.pbio.0060191.g002

    Количественные аспекты экспрессии LacZ в мыши TDLacZ

    Затем, чтобы измерить чувствительность индукции толерантности, мы оценили среднее количество антигена, экспрессируемого в тимусе одного взрослого человека, путем измерения активности β-gal белка LacZ в очищенных стромальных клетках тимуса.Мы изолировали клетки от мышей TDLacZ Δ / Δ и окрашивали их mAb против TSCOT (рис. 3A). В этом препарате с использованием 28 животных клетки TSCOT + (12,3%) соответствовали 1,2 × 10 5 клеток. Это дает в общей сложности около 4300 клеток TSCOT + на тимус. Когда этот клеточный препарат был лизирован и была оценена активность β-гал (рис. 3B и неопубликованные данные), мы смогли определить концентрацию LacZ по стандартной кривой (2 × 10 −11 M для 50 мкл реакции). .Эти числа соответствуют 5017 молекулам белка LacZ на клетку TSCOT + путем простого математического расчета концентрации × объема × числа Авогадро / числа клеток; 2 × 10 −11 M × 50/10 6 × 6,02 × 10 23 молекул в клетках 1,2 × 10 5 в показанном эксперименте. Во втором эксперименте окончательное количество составляло 6825 молекул на клетку.

    Рисунок 3. Оценка количества молекул LacZ, экспрессируемых в клетках, экспрессирующих TSCOT

    (A) Проточно-цитометрический анализ процентного содержания клеток, экспрессирующих TSCOT, в препарате тимуса.

    (B) Стандартная кривая активности фермента β-gal с использованием очищенного белка LacZ. Очищенный фермент LacZ из коммерческого источника измеряли по весу, а исходный раствор фермента серийно разбавляли для построения кривой. Открытый треугольник указывает измеренное значение для белкового экстракта, полученного из 30 гомозиготных (Δ / Δ) тимусов TDLacZ.

    https://doi.org/10.1371/journal.pbio.0060191.g003

    Может ли антиген, экспрессируемый в TSCOT

    + TEC вызывать самотолерантность?

    TDLacZ и животных дикого типа иммунизировали рекомбинантным белком LacZ и исследовали на LacZ-специфический поликлональный ответ CD4 + Т-клеток.Как показано на фиг. 4A, зависимый от концентрации LacZ-индуцированный пролиферативный ответ был обнаружен в очищенных Т-клетках лимфатических узлов CD4 + от животных B6 дикого типа, тогда как Т-клетки от мышей TDLacZ явно не показали ответа на LacZ. И гетерозиготные, и гомозиготные животные показали значительное снижение пролиферации (рис. 4В). Затем LacZ-специфические ответы антител оценивали с помощью ELISA (фиг. 4C). Когда весь белок LacZ вводили в CFA, мыши дикого типа продуцировали как изотипы IgG1, так и IgG2b, специфичные для LacZ.Напротив, гетерозиготные и гомозиготные мыши TDLacZ не продуцировали такие антитела (рис. 4C, вверху). Чтобы оценить возможность того, что это представляет толерантность на уровне В-клеток, мы ввели участок петли TSCOT (GST-Loop), меченный GST (GST-Loop) в CFA, и проверили специфические ответы антител с помощью петлевого белка, меченного His (His-Loop). ) в ELISA. В этом случае с помощью Т-клеток, специфичных для GST, как гетерозиготные, так и гомозиготные мыши TDLacZ вырабатывали столько же антител против петли IgG1 и IgG2b, сколько и мыши дикого типа (рис. 4C, внизу).Эти результаты ясно показывают, что наличие экспрессии LacZ в субпопуляции TSCOT + TEC было достаточным для толеризации LacZ-специфичных CD4 + Т-клеток, и эта толерантность не связана с отсутствием целых молекул TSCOT в животное.

    Рисунок 4. Толерантность CD4 + к LacZ у мышей TDLacZ

    (A) CD4 + Т-клетки мышей, иммунизированных 0, 0,5, 5 или 50 мкг LacZ, стимулировали 0, 1 или 10 мкг / мл LacZ.Ответы мышей, иммунизированных LacZ, показаны сплошными линиями с открытыми символами, мышей, иммунизированных адъювантом, — пунктирными линиями с закрытыми символами. Прямоугольниками обозначены + / +, а овалами Δ / Δ.

    (B) Ответ Т-клеток при иммунизации + / + (прямоугольники), Δ / + (треугольники) и Δ / Δ (овалы) с (сплошные линии и закрашенные символы) или без (пунктирные линии и незакрашенные символы) 25 мкг LacZ. Не было значительных различий в восстановлении количества клеток у иммунизированных мышей любого генотипа.

    (C) Профили изотипов антител + / +, + / Δ и Δ / Δ мышей, иммунизированных LacZ (верхние панели) или GST-TSCOT-Loop (нижние панели).Показания OD отдельной сыворотки показаны одним символом. Незакрашенные символы относятся к предиммунной сыворотке, а закрашенные символы — к иммунизированной сыворотке. Показаны уровни IgM (M), IgG1 (G1), IgG2a (G2a), IgG2b (G2b), IgG3 (G3) и IgA (A).

    https://doi.org/10.1371/journal.pbio.0060191.g004

    молекул, участвующих в TSCOT

    + TEC-опосредованной толерантности

    Поскольку известно, что AIRE играет ключевую роль в установлении толерантности к антигенам, беспорядочно / эктопически экспрессируемым в небольших количествах с помощью mTEC [44–46], мы исследовали возможную роль AIRE в TSCOT + TEC в отношении индукции толерантности.Мы скрестили TDLacZ-мышь с AIRE-дефицитной мышью и провели такой же анализ пролиферации для анти-LacZ CD4 + Т-клеточного ответа на белок LacZ. Как показано на фиг. 5, мыши с дефицитом AIRE демонстрировали слегка усиленные ответы против LacZ по сравнению с диким типом, возможно, из-за введенной перекрестной реактивности или аутореактивности. Когда одна копия LacZ была экспрессирована путем скрещивания нокаута AIRE (KO) с мышью TDLacZ, анти-LacZ-специфический пролиферативный ответ был явно снижен.В специфических ответах на 1 мкг антигена степени ответов, вносимых AIRE, были сходными (разница между диким типом и AIRE KO по сравнению с таковой между TDLacZ и TDLacZ AIRE KO). Эти результаты убедительно свидетельствуют о наличии другого пути, по которому AIRE не играет главной роли в индукции толерантности к антигену, экспрессируемому в TSCOT + TEC.

    Рисунок 5. AIRE не является необходимым для толерантности к антигенам, экспрессируемым TSCOT + TEC

    Анализы пролиферации в ответ на β-gal для CD4 лимфатических узлов + Т-клетки из LacZ-иммунизированных (10 мкг) дикого типа ( прямоугольники), TDLacZ (овалы) или AIRE-дефицитные (треугольники), или от AIRE-дефицитных мышей × TDLacZ (перевернутые треугольники).Ответы мышей, иммунизированных LacZ (+ Ag), показаны сплошными линиями с закрытыми символами, тогда как ответы мышей, иммунизированных только адъювантом (-Ag), показаны пунктирными линиями с открытыми символами.

    https://doi.org/10.1371/journal.pbio.0060191.g005

    Далее мы оценили наличие или отсутствие выбранных костимулирующих молекул и молекул адгезии в клетках, экспрессирующих TSCOT. Хотя были сообщения о том, что кортикальный эпителий не экспрессирует костимулирующую молекулу по данным гистологического анализа, у нас были основания полагать, что этот вывод может быть ложным, основываясь на нашем наблюдении несоответствия между гистологией и проточной цитометрией [47].Как показано на фиг. 6A – 6C, проточная цитометрия показала, что все клетки TSCOT + являются положительными по экспрессии MHCII, CD40 и CD54. При более подробном анализе относительный уровень CD40 в клетках TSCOT + был подобен таковому у некоторых клеток CD45 + (предположительно дендритных клеток) и выше, чем у клеток TSCOT , содержащих TSCOT популяции cTEC и mTEC. (Рисунок 6B, гистограмма). Важная костимулирующая молекула, CD80, экспрессировалась в некоторых клетках TSCOT + , как показано на Фигуре 6D (ворота CD45 и ворота CD45 MHCII hi , где находится большая часть клеток TSCOT + ).Чтобы сравнить относительные уровни CD80 между клетками mTEC и TCSOT + , применяли многопараметрический анализ проточной цитометрии и конфокальной микроскопии, включая окрашивание LacZ стромальными клетками, полученными из тимуса TDLacZ. Как видно на (Рисунки 6E, 6F и S1). В обоих анализах средняя интенсивность флуоресценции (MFI) относительных уровней CD80 была выше в TSCOT + cTEC (CDR1 + LacZ + ), чем в других клетках mTEC (UEA-1 + CDR1 ). ) и TSCOT cTEC (CDR1 + LacZ ).CD86 не был обнаружен в наших условиях, возможно, из-за чувствительности к трипсину этого маркера (неопубликованные данные). Эти результаты ясно показывают, что клетки TSCOT + могут функционировать как эффективные APC.

    Рисунок 6. Профили костимулирующих молекул и других поверхностных маркеров клеток, экспрессирующих TSCOT

    (A) Профили MHCII клеток TSCOT + (сплошная линия) и клеток TSCOT (пунктирная линия).

    (В) Профиль CD40 CD45 — вентиль слева, CD40.Справа указаны гистограммы TSCOT + , TSCOT (mTEC + cTEC) и CD45 + . Фоновая гистограмма живого гейта отображается, но не указывается.

    (В) Профиль CD54 ворот CD45 .

    (D) Профиль CD80 ворот CD45 и ворот MHCII hi .

    (E) Гистограмма уровней CD80 в mTEC (UEA-1 + CDR1 ), TSCOT + cTEC (CDR1 + LacZ + ), TSCOT cTEC (CDR323 ).Показаны специфическое окрашивание CD80 (сплошная линия) и фон (пунктирная линия) тех же ворот. Указывается процент положительных ячеек в каждом гейте, MFI отрицательного и положительного гейтов.

    (F) Паттерн экспрессии CD80 выбранных стромальных клеток TDLacZ, окрашенных CDR1 и LacZ. Показаны образцы окрашивания DIC, CDR1, LacZ и CD80.

    https://doi.org/10.1371/journal.pbio.0060191.g006

    Полная делеция моноклональных трансгенных тимоцитов TCR, специфичных для LacZ на стадии DN в присутствии эпителия TDLacZ

    Чтобы определить конкретный механизм наблюдаемой толерантности, мы использовали моноспецифическую TCR Tg мышь, BgII (D.Палмер, Марк Р. Теорет и Н. Рестифо, неопубликованные данные; см. Материалы и методы), который несет трансген против LacZ TCR из CD4 + LacZ-специфического клона Т-клеток [48]. Эта линия была скрещена с Rag1 — / — для создания моноспецифической популяции Т-клеток, несущих TCR. Когда мышь BgII Tg / Tg Rag1 — / — была скрещена с TDLacZ Δ / Δ Rag1 — / — мыши, гетерозигота для TCR Tg и TDLacZ, только CD4 CD8 клетки были обнаружены в меньшем тимусе (рис. 7).Общее количество извлеченных тимоцитов составило приблизительно 17,5% от того, что было извлечено из мышей TCR Tg. Большинство клеток было арестовано на стадии CD25 hi CD44 (DN3), аналогично тому, что наблюдалось у мышей Rag1 — / — (фигура 7B). Однако массовая гибель клеток в DN, а также в клетках CD4 и / или CD8 была обнаружена только у мышей BgII Tg + TDLacZ Δ / + (рис. 7C). Напротив, в одном только BgII Tg фракция клеток CD44 CD25 (DN4) имела самую высокую субпопуляцию DN (фиг. 7B).Таким образом, в присутствии LacZ тимоциты TCR Tg, по-видимому, были существенно удалены на стадии пост-DN3, как только они экспрессировали свой TCR на поверхности клетки (см. Рисунки S2 и S3 для экспрессии гена и белка TCR на клеточной поверхности). поверхность).

    Рисунок 7. Анти-LacZ-специфические трансгенные тимоциты, несущие TCR, удаляются на стадии DN в присутствии экспрессии TSCOT-LacZ

    (A) Профили тимоцитов CD4 и CD8. Названия каждого из четырех использованных линий мышей и их общий выход тимоцитов показаны над графиками.Процентное соотношение подмножеств однократного и двойного окрашивания показано в четырех квадрантах.

    (B) Профили CD25 и CD44 тимоцитов DN с процентным соотношением в квадрантах.

    (C) Окрашивание аннексином V всех клеток, окрашенных CD4, CD8 и PI, показано в канале FL3. Ячейки PI + находятся вверху, ячейки DP и SP в середине, а ячейки DN внизу.

    (D) Профили UEA-1 и CDR1 компартмента стромальных клеток CD45 из четырех разных линий мышей.Генотипы каждой мыши проверяются по локусам α- и β-цепей Rag1, TDL и TCR с помощью ПЦР

    .

    https://doi.org/10.1371/journal.pbio.0060191.g007

    Образец стромальных клеток тимуса (стромальных клеток CD45 ), наблюдаемых в BgII Tg / + TDLacZ Δ / + Rag1 Мыши — / — также были подобны мышам Rag1 — / — (фигура 7D). MTEC UEA1 + , которые являются заметными в тимусе взрослого дикого типа, были едва обнаружены, и, таким образом, доля cTEC CDR1 + была значительно увеличена.Следовательно, мыши BgII Tg / + TDLacZ Δ / + Rag1 — / — не обладают полностью развитыми mTEC, но они по-прежнему способны эффективно удалять развивающиеся тимоциты.

    Кросс-презентация DC или mTEC не участвует в CDR1 + cTEC-опосредованной делеции

    Чтобы исключить возможность перекрестной презентации mTEC и DC в индукции толерантности, мы использовали чистую реактивную систему культивирования органов тимуса (RTOC) [49,50], используя восстановленную UEA-1– и CD45-обедненную строму тимуса. с очищенными трансгенными тимоцитами против LacZ TCR.Стромальные клетки получали из фетальной культуры органов тимуса E14.5 в присутствии 2-dGuo, который истощает DC, и популяция была дополнительно истощена по клеткам CD45 + и UEA-1 + путем разделения магнитных шариков. . Использование таких клеток, выделенных из образцов тимуса дикого типа или TDLacZ + / Δ , клеток DN и DP, несущих анти-LacZ TCR (соотношение 1:10, аналогично нормальному тимусу) из взрослых BgII Tg / Tg животных реагрегировали с ними и культивировали в течение 5–6 дней.Как показано на Рисунке 7, восстановление тимоцитов из RTOC с помощью TDLacZ cTECs составляло 5-20% от того, что было достигнуто со стромой дикого типа. Кроме того, эти культуры не содержали значительного количества CD4-одноположительных (SP) клеток (фиг. 8A). Когда трансгенные тимоциты DN и DP были по отдельности повторно агрегированы с TDLacZ cTEC (фиг. 8B), обе субпопуляции показали уменьшенное количество клеток после культивирования, что указывает на то, что экспрессия LacZ может также истощить LacZ-отвечающие клетки DP в RTOC.Хотя эти результаты опровергают идею нарушения дифференцировки от DN к стадии DP, они предполагают, что развивающиеся тимоциты удаляются, как только они вступают в реакцию с антигенами, представленными в корковом эпителии тимуса.

    Рисунок 8. DC и mTEC не являются необходимыми для делеции трансгенных тимоцитов

    Отсортированные тимоциты против LacZ TCR были повторно агрегированы с истощенными UEA-1 стромальными клетками CD45 из dGuo-обработанных тимусов плода. (A) Профили проточной цитометрии реаггрегатных культур, инициированных 3.8 × 10 5 DN + DP (соотношение 1:10) и 5 ​​× 10 5 очищенная строма тимуса на 5 день (вверху) или на 6 день (внизу). Источники стромальных клеток и тимоцитов указаны вверху графиков. Профили CD4 и CD8 показаны вместе с процентным содержанием клеток в каждом из отделений. Обычно восстановление клеток смесей тимоцитов DN и DP, культивируемых с гетерозиготной (+ / Δ) стромой TDLacZ, составляло 20-30% от смесей тимоцитов, культивированных со стромой дикого типа (+ / +).

    (B) Типичное восстановление клеток, когда клетки DN и DP культивировали отдельно с очищенной стромой дикого типа (+ / +) по сравнению с мышью гетерозиготной (+ / Δ).Подчеркнутые числа указывают начальное количество введенных ячеек.

    https://doi.org/10.1371/journal.pbio.0060191.g008

    Обсуждение

    В этом отчете мы исследовали индукцию толерантности к TSCOT + субпопулярному антигену TEC. Наши результаты демонстрируют, что небольшое количество антигена (несколько тысяч на клетку), присутствующее в небольшом количестве подмножества ТЕС (4000 клеток / тимус), функционирует как высокоэффективный толероген среди разнообразного репертуара.Кроме того, кортикальный маркер CDR1 + TEC удаляет тимоциты TCR + Tg без перекрестной презентации ни DC, ни mTEC. Этот тип толерантности был установлен, по крайней мере, частично независимо от AIRE.

    Допуск по TSCOT

    + CDR1 + MHCII hi Компартмент в микросреде тимуса

    Из гистологических анализов уже известно, что микроокружение тимуса имеет сложную природу и изменяется в процессе развития [41,51–53].Кроме того, гистологические анализы сами по себе не являются подходящим методом для определения профилей экспрессии для различных компартментов из-за плохого кортикального окрашивания [43]. Используя комбинацию проточной цитометрии с компартмент-специфическими маркерами [43] и окрашиванием репортера LacZ, кортикальная экспрессия локуса TSCOT была подтверждена на стадии новорожденного (рис. 2A и [37,41,51–53]). В зрелом тимусе активность β-gal также в основном обнаруживалась в коре головного мозга (рис. 2B), а поверхностная экспрессия TSCOT была обнаружена исключительно в популяциях CDR1 + TEC, а не в обычных mTEC или неэпителиальных клетках (рис. 2C).Однако в некоторых случаях окрашивание активности LacZ распространяется на кортикомедуллярное соединение зрелого тимуса TDLacZ, а маркер TSCOT также окрашивает нехарактеризованную минорную популяцию клеток (неопубликованные данные). Часть этих второстепенных популяций могла бы разрабатывать переходные TEC, но эта возможность требует дальнейшего детального изучения с помощью улучшенной технологии, которая может обрабатывать чрезвычайно небольшое количество клеток. Тем не менее ясно, что клетки TSCOT + не являются частью обычных медуллярных клеток.TSCOT / LacZ никогда не обнаруживался в традиционной популяции mTEC CDR1 UEA-1 + (рис. 2C). Таким образом, мы можем исключить возможность того, что LacZ эктопически экспрессируется в mTEC мозгового вещества. Более того, экспрессия TSCOT широко локализовалась в тимусе Rag1 — / — [38], в котором отсутствуют зрелые mTEC (Рисунок 7C и [54]). В случае мышей BgII на фоне Rag1 — / — толерантность на стадии DN была очень четкой, когда антиген был только в кортикальном эпителии (Рисунок 7).

    Идея исключения кортикального эпителия в индукции толерантности была получена из трансгенной экспрессии молекул MHC исключительно в коре тимуса с использованием промотора K14 [25,26]. Однако идея исключительной ниши толерантности подверглась сомнению: неполнота, но значительная толерантность наблюдалась, когда другие антигены были нацелены на cTEC с использованием того же промотора [27,28]. Кроме того, было ясно продемонстрировано, что вилочковая железа K14-MHCII на самом деле является аутотолерагенной, когда аутоантигены представлены его собственными кортикальными эпителиальными клетками [22].Наши текущие результаты с использованием конкретного промотора TSCOT подтверждают мнение о том, что cTEC участвует в установлении центральной толерантности к CD4 очень эффективным образом. Нет никаких доказательств аутореактивности к специфическим антигенам, представленным клетками TSCOT + . Вместо этого мы обнаружили четкую толерантность к антигену LacZ. Следовательно, ниша TSCOT + TEC субпопуляции cTEC не исключена из индукции толерантности, так что она может избежать аутореактивности против своей собственной клетки.

    Механизм индукции толерантности с помощью TSCOT

    + TEC Subset

    Воспользовавшись чувствительной ферментативной активностью, наша оценка для LacZ под контролем промотора TSCOT составляет около 6000 (среднее из двух измерений) молекул на TSCOT + TEC в гомозиготном тимусе (рис. 3). Это число удивительно похоже на оценку mTEC, полученную по косвенной оценке [55]. Однако половины этого количества у гетерозигот было достаточно для индукции полной толерантности к CD4 в отсутствие mTEC (Фигуры 7 и 8) или перекрестной презентации DC (Фигуры 8).Предыдущие точные оценки [56] показали, что распознавание незрелыми тимоцитами только трех-четырех комплексов пептид / MHC было достаточным, чтобы вызвать событие отрицательного отбора у трансгенных мышей. Таким образом, остается сложным вопрос, как достичь такого высокого КПД. Количество cTEC во взрослой вилочковой железе намного меньше, чем mTEC [43]. Общее количество TSCOT + TEC, оцененное из большого пула тимусов взрослых, было всего порядка нескольких тысяч на тимус.Чтобы проверить все развивающиеся тимоциты на потенциальную аутореактивность, необходимо оптимизировать частоту встреч клеток между cTEC, представляющими специфический антиген, и тимоцитами, даже с учетом среднего 3-дневного периода, в течение которого тимоциты DP остаются в коре головного мозга [57 , 58]. Это может быть достигнуто в питательных клетках тимуса, в которых несколько тимоцитов обнаруживаются в ассоциации с одной эпителиальной клеткой.

    В нескольких более ранних работах был сделан вывод, что эпителий тимуса индуцирует толерантность за счет индукции анергии, а не делеции [59,60].Напротив, в нашей модели анти-LacZ TCR Tg × TDLacZ очевидно, что делеция является доминирующим механизмом (Рисунок 7). Делеция также наблюдалась в ряде других трансгенных систем TCR [28,61]. Был поставлен вопрос о том, является ли это нормальным физиологическим процессом или смертью после остановки развития после преждевременной экспрессии трансгенного рецептора на стадии DN [62]. Однако тимоциты DP, включенные в RTOC, также были удалены, аргументируя это тем, что толерантность, индуцированная cTEC, включает специфическую делецию, а не остановку на стадии преждевременного развития (Рисунок 8B).

    В тимусе TDLacZ кортикальный эпителий, экспрессирующий специфический антиген, был способен достаточно тщательно толеризоваться (Фигуры 7 и 8). Это было несколько удивительно, если эпителиальные клетки тимуса являются плохими презентаторами антигена, как было сделано ранее о плохой экспрессии костимулирующих молекул в cTEC [63]. Однако мы ясно показали, что TSCOT + cTEC экспрессируют высокие уровни MHCII, CD54, CD40 и CD80. В частности, поверхностные белки CD40 и CD80 экспрессируются на неожиданных уровнях, которые даже выше, чем у mTEC (фиг. 6).Согласно результатам ОТ-ПЦР очищенных клеток, уровни сообщений CD40, CD80 и CD86 несколько выше в mTEC, чем cTEC ([37] и неопубликованные данные). Среди cTEC клетки TSCOT + экспрессируют больше костимулирующих молекул (рисунки 6 и S1). Следовательно, молекулы на TSCOT + cTEC могут обеспечивать среду для высокоэффективной делеционной толерантности TCR, несущих ранние тимоциты (рис. S2) посредством уникального процесса презентации антигена cTEC TSCOT + .Как видно на фигуре 7C, массовые события апоптоза в трансгенных клетках DN TCR в присутствии cTEC, несущего антиген LacZ, также согласуются с делеционной толерантностью.

    Чтобы определить молекулярный механизм, лежащий в основе индукции толерантности, мы определили, участвует ли AIRE. Достаточно хорошо установлено, что AIRE участвует в индукции толерантности, опосредованной mTEC, облегчая экспрессию периферических антигенов у нормальных и генетически модифицированных животных [12, 64, 65].В результате введения одной копии гена LacZ животным с дефицитом AIRE, LacZ-специфический пролиферативный ответ CD4 был значительно снижен (рис. 5). Поскольку в большинстве случаев предполагалось, что экспрессия AIRE отсутствует в нормальном CDR1 + cTEC (за исключением Rag1 — / — ), неудивительно, что AIRE не участвует непосредственно в TSCOT + TEC-индуцированной толерантности. Вместо этого можно предположить, что AIRE-независимый путь толерантности существует в TSCOT + TEC.Однако все еще оставался вопрос, индуцируется ли толерантность экспрессирующими AIRE DC или mTEC посредством перекрестной презентации. Результаты, полученные с помощью RTOC с использованием тимоцитов от трансгенных мышей с LacZ-специфическим TCR и очищенных клеток CD45 UEA-1 CDR1 + из клеток FTOC, обработанных 2-dGuo (рис. 7), показывают, что ни DC, ни mTEC не нужны. для индукции толерантности in vitro. Прямое участие TSCOT + TEC в делеционной толерантности является убедительным доказательством способности прямой презентации антигена [29,32–36].Для определения конкретных молекул, участвующих в этом типе презентации антигена, потребуются более подробные исследования.

    Достаточно ли моделей сродства / авидности для объяснения центральной толерантности кортикального эпителия?

    Принято считать, что отрицательный отбор требует определенных условий либо высокоавидного взаимодействия, либо продолжительной передачи сигналов [20,66,67]. Количественные аспекты, обсужденные выше, кажутся недостаточными, чтобы объяснить отрицательный отбор простой моделью аффинности / авидности для cTEC.Поверхностный и цитоплазматический уровни MHCII в cTEC не намного ниже, чем в mTEC, а молекулы MHCII существуют на cTEC в виде агрегатов на поверхности [43]. Таким образом, если собственный пептид был представлен в достаточно высоких концентрациях для отображения множества комплексов в одном и том же агрегате в любой момент времени, эти агрегаты MHCII потенциально могли бы генерировать передачу сигналов высокой авидности, ведущую к гибели тимоцитов. Если это так, то кортикальный эпителий может функционировать напрямую как при отрицательном, так и при положительном отборе.В соответствии с этим представлением было показано, что одна линия cTEC может опосредовать как положительный, так и отрицательный отбор [68]. Если количество любого антигена, продуцируемого cTEC, невелико, то при нормальных условиях со случайным механизмом загрузки для разнообразного набора эндогенных пептидов [69] единственный агрегат MHCII на поверхности cTEC, вероятно, будет содержать только один комплекс пептид / MHC. . Это помешало бы работе механизма, основанного на жадности, поскольку не было бы мультимерной презентации. Хотя такое мономерное представление могло бы быть адекватным для положительного отбора, кажется, что оно было бы неадекватным для отрицательного отбора.Это повышает вероятность того, что могут существовать другие механизмы для увеличения плотности антигена на cTEC. Такой механизм может включать межклеточный перенос антигена [70] в дополнение к отбору других пулов аутоантигена [8,71]. Однако экспрессия костимулирующих молекул на TSCOT + cTECs согласуется с идеей о том, что наличие костимуляции / вторых сигналов может отличать отрицательный от положительного отбора.

    Материалы и методы

    Мыши.

    Со всеми мышами обращались в соответствии с правилами Американской ассоциации по аккредитации лабораторных животных.

    Для создания мышей, несущих встроенный аллель LacZ в локус TSCOT, был сконструирован целевой вектор размером 4,2 т.п.н. путем клонирования IRES-LacZ с неоселективным маркером из p1049 [42] между двумя сайтами BamHI в первом экзоне гена TSCOT . Кассету экспрессии тимидинкиназы вируса простого герпеса (HSV-TK) помещали на 5′-конце конструкции, чтобы облегчить отрицательный отбор на гомологичную рекомбинацию.Целевой аллель содержит кассету экспрессии IRES-LacZ и PGK-неомицина в первом экзоне, что приводит к небольшой делеции (284 п.н.) между двумя сайтами BamHI в экзоне 1. Линия эмбриональных стволовых клеток мыши 129 (R1) была электропорирована с помощью конструкция и устойчивые к неомицину клоны были проверены в лаборатории доктора Хуа Гу (Национальный институт аллергии и инфекционных заболеваний [NIAID] / Национальные институты здравоохранения [NIH]). Химеры были получены путем инъекции бластоцисты, и одна мышь-основатель была скрещена с C57BL / 6Tac.

    Для изучения антиген-специфических ответов Т-клеток CD4 + на β-gal была разработана линия трансгенных мышей на фоне C57BL / 6, названная BgII. РНК была выделена из I-Ab-рестриктированного, β-gal-специфичного клона CD4 + Т-клеток. Тотальную мРНК выделяли с помощью набора Qiagen RNeasy, а α и β TCR амплифицировали с помощью 5′-быстрой амплификации концов кДНК (5′-RACE, Life Technologies) с использованием антисмысловых праймеров константной области a1 (5′-GGCTACTT TCAGCAGGAGGA -3 ‘) и b1 (5′-AGGCCTCTGCACTGATGTTC-3′) соответственно.Продукты 5’-RACE амплифицировали с вложенными праймерами константной области α и β TCR a2 (5′-GGGAGTCAAAGTCGGTGAAC-3 ′) и b2 (5′-CCACGTGGTCAGGGAAGAAG-3 ′) и клонировали в векторы секвенирования pCR4TOPO TA (Invitrogen). Праймеры для ПЦР для геномного клонирования были сконструированы на основе ранее описанного метода [72]. Геномные вариабельные домены были клонированы TA в pCR4TOPO (Invitrogen), подтверждены секвенированием, субклонированы в кассетные векторы TCR, любезно предоставленные доктором Дайан Матис (Гарвард), и совместно введены в оплодотворенные эмбрионы C57BL / 6 (SAIC), дающие трансгенного основателя TCR, который был потом разводили.

    Генотипирование методом ПЦР.

    Образцы хвоста или ушей были использованы для генотипирования с использованием набора для ПЦР красной ткани Extract-N-Amp (Sigma) и праймеров: для локуса TSCOT, Neo-праймер: ACCGCTATCAGGACATAGCGTTGG, 1C12 F1: TTACTCAAAGTTTGATGCTGACTGACGGG12; для локуса RAG1 праймер Neo: ACCGCTATCAGGACATAGCGTTGG, Rag-1 F: TCGTTTCAAGAGTGACGGGCAC, Rag-1 B: AATCCTGGCAATGAGGTCTGG; и для локуса AIRE прямой праймер: GTCATGTTGACGGATCCAGGGTAGAAAGT, обратный праймер: AGACTAGGTGTTCCCTCCCAACCTCAG.Для трансгенного аллеля против LacZ TCR, BG2 Alpha F1: ACAACCCGGGATTGGACAG, BG2 Alpha R1: GTATAGCGGCCGCCTCCTAGTGCAATGGT, BG2 Beta F1: TATCTCGAGTCCTGCCGTGACCCTACTATG; BG2 Бета R1: CAGCCGCGGAACCCAACACAAAAACTATAC.

    Проточная цитометрия.

    Антитела, используемые для проточного цитометрического анализа, были следующими: для стромальных клеток, FITC-конъюгированные антимышиные IA b (A b ) AF6–120.1 (BD Pharmingen), CDR1-PE (получены L. Lantz, NIAID проточная цитометрия), конъюгат CD45 PE-Texas Red (Caltag), биотинилированный агглютинин-1 Ulex europaeus (Vector Laboratories), стрептавидин-APC (BD Pharmingen), mAb против TSCOT CLVE1 (подготовлено доктором Dr.L. Lanz, NIAID) и FITC-конъюгированные козьи антитела против IgM крысы (Jackson Laboratories). Для тимоцитов, FITC-конъюгированный антимышиный CD4 (L3T4) (GK1.5) (BD Pharmingen), PE-конъюгированный антимышиный CD44 (BD Pharmingen), конъюгат мышиный CD8α PE-Texas Red (Caltag), конъюгированный с биотином анти-CD44 мыши. CD25 мыши (BD Pharmingen), стрептавидин-APC (BD Pharmingen), аннексин V-FITC (Clontech), PE-конъюгированный антимышиный CD69 (BD Pharmingen), конъюгат CD4 PE-Texas Red (Caltag), биотиновый антимышиный αβTCR (H57-597) (BD Pharmingen), FITC-конъюгированные антимышиные CD44 (BD Pharmingen), PE-конъюгированные антимышиные CD25 (BD Pharmingen), APC-конъюгированные антимышиные CD4 (L3T4) (GK1.5) (BD Pharmingen) и APC-конъюгированные антитела против CD8α мыши (BD Pharmingen). Для окрашивания LacZ, после обработки 30 мМ хлорохиндифосфата для блокирования эндогенной активности β-гал в течение 30 мин при 37 ° C, 33 мкМ субстрата ImaGene Red C12RG (Molecular Probes, ImaGene Red C12RG lacZ Gene Expression Kit I-2906) использовали в Буфер для FACS в течение 20 мин при 4 ° C.

    Активность β-галактозидазы и окрашивание антител.

    Целые эмбрионы или изолированные тимусы промывали PBS и фиксировали в 1% параформальдегиде, 0.2% глутарового альдегида, 0,02% NP-40, 1 мМ MgCl 2 в PBS в течение 1 или 2 ч на льду. Окрашивание проводили с использованием раствора X-gal со 100 мМ d-галактозы в 2 мМ MgCl 2 , 5 мМ феррицианиде калия, 5 мМ ферроцианиде калия в течение ночи при 37 ° C [42]. Для срезов вилочковые железы помещали в среду для замораживания тканей (Triangle Biomedical Sciences). Срезы размером 4 мкм фиксировали в течение 2 минут в 1% формальдегиде, 0,2% глутаральдегиде, 0,02% NP-40, 1 мМ NaCl, затем инкубировали с раствором X-gal (1 часть X-gal 40 мг / мл в диметилформамиде, в 40 частей 2 мМ MgCl 2 , 5 мМ феррицианида калия, 5 мМ ферроцианида калия в PBS) при 37 ° C в течение 48 часов.Для окрашивания антител парафиновые срезы окрашивали реагентом DAKO CSA. Для анализа LacZ Lysis клетки тимуса от 30 мышей TDLacZ или контрольных мышей C57BL / 6 частично очищали посредством сортировки шариков MACS CD45 (Miltenyi Biotech). Осадки клеток лизировали с использованием буфера для репортерного лизиса из системы анализа ферментов β-галактозидазы с буфером для репортерного лизиса (Promega). После лизиса и центрифугирования буфер для анализа добавляли к каждому супернатанту, а также к аликвотам фермента для стандартной кривой, а затем инкубировали в течение 30 минут при 37 ° C.Затем измеряли поглощение на длине волны 405 нм.

    Цитоспиновая и конфокальная микроскопия.

    Изолированный TEC (около 10 5 ) промывали холодным буфером FACS (PBS + 1% BSA), затем окрашивали на льду 2,4G2, APC-конъюгированным анти-CDR1, биотинилированным анти-CD80 (B7–1, армянский хомяк). IgG2κ), а затем стрептабидин-Alexa568 (Molecular Probes). Для обнаружения клеток, экспрессирующих LacZ, использовали набор ImaGene Green C 12 FDG lacZ Gene Expression (Molecular Probes).Окрашенные образцы помещали на предметные стекла цитоспином при 1200 об / мин в течение 2 минут. Изображения собирали на LSM 510 META (Zeiss) и анализировали с помощью LSM Image Examiner (Zeiss) и Photoshop.

    CD4

    + Анализ пролиферации Т-клеток in vitro.

    По три мыши в группе иммунизировали аффинно очищенными рекомбинантными белками, удаленными от ЛПС, в полном адъюванте Фрейнда в подушечку одной лапы и основание хвоста. Через десять дней после иммунизации мышей умерщвляли, собирали паховые, брыжеечные и парааортальные лимфатические узлы и измельчали ​​в модифицированной среде Дульбекко Искова.Клетки CD4 + собирали из колонок MACS с использованием антитела против CD4 (GK1.5) (чистота клеток обычно превышала 95%) и инкубировали при 37 ° C с облученными целыми клетками селезенки и 0, 1, 10, или 100 мкг белка LacZ (в трех экземплярах). Клеткам вводили 3 H-тимидин в течение последних 24 часов 72-часовой инкубации. Клетки собирали с помощью 96-луночного харвестера Brandel, и включение тимидина в ДНК измеряли с помощью β-сцинтилляционного счетчика Wallac Trilux 1450.

    Обнаружение антител к LacZ методом ELISA.

    Мышей иммунизировали внутрибрюшинно либо LacZ, либо очищенным рекомбинантным белком GST-TSCOT-Loop в CFA три раза каждые две недели. У мышей брали кровь через 3 дня после последней инъекции, и сыворотки инкубировали на планшетах для ELISA, покрытых His-LacZ или покрытых His-Loop (5 мкг / лунка). Связанное антитело против LacZ обнаруживали с помощью антител против изотипа иммуноглобулина мыши, конъюгированных с HRP, и анализировали с раствором ABTS (Southern Biotechnology Associates), следуя описанию производителя.Оптическую плотность (OD) измеряли при 405 нм.

    Реагрегировать культуру органов тимуса (протокол Андерсона и Дженкинсона).

    Стромальные клетки тимуса получали обработкой образцов тимуса плода E14.5 2-dGuo в течение недели. Затем клетки UEA-1 и CD45 очищали с использованием биотинилированных реагентов и гранул стрептавидин-MACS. Тимоциты трансгенных мышей против LacZ TCR были отсортированы на клетки DP и DN и повторно агрегированы со стромальными клетками с использованием протоколов, разработанных Андерсоном и Дженкинсоном из Университета Бирмингема, Соединенное Королевство [49].Выделенные клетки подсчитывали, а затем анализировали проточной цитометрией через 4–6 дней культивирования.

    Дополнительная информация

    Рисунок S1. Количественный анализ CD80 mTEC, TSCOT

    + cTEC и TSCOT cTEC

    Анализ выполняли с использованием данных конфокальной микроскопии. Уровни CD80 измеряли, используя сумму интенсивностей в клеточной области над фоном (TINA2.09f, Пусанский национальный университет). Процент максимума (макс.) Рассчитывали со средним значением трех клеток CDR1 + LacZ + .Полосы и точки представляют собой среднее значение и каждое значение соответственно. Звездочка указывает на то, что область из соседней ячейки была исключена для измерения.

    https://doi.org/10.1371/journal.pbio.0060191.sg001

    (2,09 МБ TIF)

    Рисунок S3. Экспрессия трансгенного TCR во время развития тимоцитов

    Уровни

    TCR определяли с помощью антитела против цепи TCRb (H57) в комбинации с другими антителами при проточной цитометрии. Профили CD4 и CD8, а также ворота DN, DP и CD4 показаны на верхней левой панели; Уровни TCR соответствующих ворот показаны в правом верхнем углу.Слева внизу показаны вентильные профили CD44 и CD25, а также вентили DN1, DN2 + 3 и DN4. Уровни TCR соответствующих ворот DN показаны в правом нижнем углу. Сплошные линии на гистограмме показывают уровни TCR каждого гейта у трансгенной мыши CD4 TCR; пунктирные линии показывают те же самые gated у мышей B6 дикого типа.

    https://doi.org/10.1371/journal.pbio.0060191.sg003

    (3,35 МБ TIF)

    Благодарности

    Мы благодарим Heonsik Choi и See Young Choi за их техническую помощь на различных этапах этой работы.Мы очень признательны доктору Хва Гу за создание мышей и доктору Ларри Ланцу за производство критических антител. Мы благодарим докторов наук. Рональду Шварцу, Полли Матцингер, Би Джей Фаулксу, Элу Сингеру и Чон Хи Чангу за их полезные советы при написании этой работы. Мы хотели бы поблагодарить доктора. Ханун Ли, Донгын Пак и Ынён Чой за помощь в разведении мышей. Особая благодарность д-ру Фрэнку Фломерфельту за личное сообщение о результатах с мышами 5CC7.

    Вклад авторов

    MGK задумал и разработал эксперименты.SA, GL, SJY, DL, HSS, MCK и MGK проводили эксперименты. SA, GL, SJY, DL, SL, HSS, MCK, EJJ, GA и MGK проанализировали данные. KNL, DCP, MRT, EJJ, GA, NPR и MGK предоставили реагенты / материалы / инструменты для анализа. Документ написали SA, GL, SJY, DL, SL, DCP, GA, NPR и MGK.

    Список литературы

    1. 1. Sprent J, Lo D, Gao EK, Ron Y (1988) Выбор Т-клеток в тимусе. Immunol Rev 101: 173–190.
    2. 2. Охаши П.С. (2003) Отрицательный отбор и аутоиммунитет.Curr Opin Immunol 15: 668–676.
    3. 3. Schwartz RH (2003) Т-клеточная анергия. Анну Рев Иммунол 21: 305–334.
    4. 4. Арнольд Б., Шонрих Г., Хаммерлинг Г. Дж. (1993) Несколько уровней периферической толерантности. Иммунол Сегодня 14: 12–14.
    5. 5. Coutinho A (2000) Селекция зародышевой линии обеспечивает аутореактивность эмбриона и позитивное различение самоопосредованных супраклональных механизмов. Семин Иммунол 12: 205–213.
    6. 6. Матцингер П. (2002) Модель опасности: обновленное чувство собственного достоинства.Наука 296: 301–305.
    7. 7. Андерсон Г., Лейн П.Дж., Дженкинсон Э.Дж. (2007) Создание интратимических микроокружений для установления толерантности к Т-клеткам. Nat Rev Immunol 7: 954–963.
    8. 8. Kyewski B, Rottinger B, Klein L (2000) Повышение эффективности толерантности центральных Т-клеток: стромальные клетки тимуса отбирают различные пулы аутоантигенов. Curr Top Microbiol Immunol 251: 139–145.
    9. 9. Kyewski B, Derbinski J (2004) Саморепрезентация в тимусе: расширенный вид.Nat Rev Immunol 4: 688–698.
    10. 10. Kyewski B, Klein L (2006) Центральная роль центральной толерантности. Анну Рев Иммунол 24: 571–606.
    11. 11. Питканен Дж, Петерсон П. (2003) Аутоиммунный регулятор: от потери функции до аутоиммунитета. Genes Immun 4: 12–21.
    12. 12. Villasenor J, Benoist C, Mathis D (2005) AIRE и APECED: молекулярное понимание аутоиммунного заболевания. Immunol Rev 204: 156–164.
    13. 13. Хейно М., Петерсон П., Кудо Дж., Нагамин К., Лагерстедт А. и др.(1999) Аутоиммунный регулятор экспрессируется в клетках, регулирующих иммунную толерантность в мозговом веществе тимуса. Biochem Biophys Res Commun 257: 821–825.
    14. 14. Когава К., Нагафучи С., Кацута Х., Кудо Дж., Тамия С. и др. (2002) Экспрессия гена AIRE в периферических моноцитах / дендритных клетках. Immunol Lett 80: 195–198.
    15. 15. Дербинский Дж., Габлер Дж., Брорс Б., Тирлинг С., Джоннакути С. и др. (2005) Беспорядочная экспрессия генов в эпителиальных клетках тимуса регулируется на нескольких уровнях.J Exp Med 202: 33–45.
    16. 16. Gallegos AM, Bevan MJ (2004) Центральная толерантность к тканеспецифическим антигенам, опосредованная прямым и непрямым представлением антигена. J Exp Med 200: 1039–1049.
    17. 17. Houssaint E, Flajnik M (1990) Роль эпителия тимуса в приобретении толерантности. Immunol Today 11: 357–360.
    18. 18. Klein L, Kyewski B (2000) Презентация аутоантигена стромальными клетками тимуса: тонкое разделение труда. Curr Opin Immunol 12: 179–186.
    19. 19. Laufer TM, Glimcher LH, Lo D (1999) Использование анатомии тимуса для анализа выбора репертуара Т-клеток. Семин Иммунол 11: 65–70.
    20. 20. Старр Т.К., Джеймсон С.К., Хогквист К.А. (2003) Положительный и отрицательный отбор Т-клеток. Анну Рев Иммунол 21: 139–176.
    21. 21. Bonomo A, Matzinger P (1993) Эпителий тимуса индуцирует тканеспецифическую толерантность. J Exp Med 177: 1153–1164.
    22. 22. Goldman KP, Park CS, Kim M, Matzinger P, Anderson CC (2005) Кортикальный эпителий тимуса индуцирует самотолерантность.Eur J Immunol 35: 709–717.
    23. 23. Pimenta-Araujo R, Mascarell L, Huesca M, Cumano A, Bandeira A (2001) Эмбриональный эпителий тимуса, естественно лишенный APC, резко отторгается в отсутствие косвенного распознавания. J Immunol 167: 5034-5041.
    24. 24. Ready AR, Jenkinson EJ, Kingston R, Owen JJ (1984) Успешная трансплантация через главный барьер гистосовместимости обработанного дезоксигуанозином эмбрионального тимуса, экспрессирующего антигены класса II. Природа 310: 231–233.
    25. 25. Laufer TM, DeKoning J, Markowitz JS, Lo D, Glimcher LH (1996) Неоспоримый положительный отбор и аутореактивность у мышей, экспрессирующих MHC класса II только на коре тимуса. Природа 383: 81–85.
    26. 26. Capone M, Romagnoli P, Beermann F, MacDonald HR, van Meerwijk JP (2001) Диссоциация положительного и отрицательного отбора тимуса у трансгенных мышей, экспрессирующих молекулы класса I главного комплекса гистосовместимости исключительно на кортикальных эпителиальных клетках тимуса.Кровь 97: 1336–1342.
    27. 27. Фрейзер И.Х., Фернандо Г.Дж., Фаулер Н., Леггатт Г.Р., Ламберт П.Ф. и др. (1998) Расщепленная толерантность к вирусному антигену, экспрессируемому в эпителии тимуса и кератиноцитах. Eur J Immunol 28: 2791–2800.
    28. 28. Майерова Д., Хогквист К.А. (2004) Центральная толерантность к аутоантигену, экспрессируемому кортикальными эпителиальными клетками. J Immunol 172: 851–856.
    29. 29. Volkmann A, Zal T, Stockinger B (1997) Антиген-презентирующие клетки в тимусе, которые могут отрицательно выбирать Т-клетки, ограниченные MHC класса II, распознающие циркулирующий аутоантиген.J Immunol 158: 693–706.
    30. 30. Goldschneider I, Cone RE (2003) Центральная роль периферических дендритных клеток в индукции приобретенной толерантности к тимусу. Тенденции Immunol 24: 77–81.
    31. 31. Bonasio R, Scimone ML, Schaerli P, Grabie N, Lichtman AH и др. (2006) Клональная делеция тимоцитов циркулирующими дендритными клетками, возвращающимися в тимус. Nat Immunol 7: 1092–1100.
    32. 32. Хенгартнер Х., Одерматт Б., Шнайдер Р., Шрейер М., Валле Г. и др.(1988) Удаление аутореактивных Т-клеток перед проникновением в мозговой тимус. Nature 336: 388–390.
    33. 33. Murphy KM, Heimberger AB, Loh DY (1990) Индукция антигеном интратимического апоптоза тимоцитов CD4 + CD8 + TCRlo in vivo. Наука 250: 1720–1723.
    34. 34. Lorenz RG, Allen PM (1989) Эпителиальные клетки коры тимуса могут представлять аутоантигены in vivo. Nature 337: 560–562.
    35. 35. Касай М., Хирокава К., Кадзино К., Огасавара К., Тацуми М. и др.(1996) Различия в путях презентации антигена между кортикальными и мозговыми эпителиальными клетками тимуса. Eur J Immunol 26: 2101–2107.
    36. 36. Mizuochi T, Kasai M, Kokuho T., Kakiuchi T., Hirokawa K (1992) Медуллярные, но не кортикальные эпителиальные клетки тимуса представляют растворимые антигены для хелперных Т-клеток. J Exp Med 175: 1601–1605.
    37. 37. Грей Д.Х., Сич Н., Уэно Т., Милтон М.К., Листон А. и др. (2006) Кинетика развития, обновление и стимулирующая способность эпителиальных клеток тимуса.Кровь 108: 3777–3785.
    38. 38. Ким М.Г., Фломерфельт Ф.А., Ли К.Н., Чен С., Шварц Р.Х. (2000) Предполагаемый котранспортер трансмембранных доменов с 12 доменами, экспрессируемый в корковых эпителиальных клетках тимуса. J Immunol 164: 3185–3192.
    39. 39. Чен С., Ким М.Г., Су Лю М., Козак К.А., Шварц Р.Х. и др. (2000) Характеристика мышиного гена, человеческого промотора и человеческой кДНК TSCOT выявила сильную межвидовую гомологию. Biochim Biophys Acta 1493: 159–169.
    40. 40. Rouse RV, Bolin LM, Bender JR, Kyewski BA (1988) Моноклональные антитела, реагирующие с подмножествами эпителиальных клеток тимуса мыши и человека.J Histochem Cytochem 36: 1511–1517.
    41. 41. Ян С.Дж., Ан С., Парк С.С., Чой С., Ким М.Г. (2005) Идентификация субпопуляций эпителиальных клеток тимуса с помощью проточной цитометрии с использованием нового специфического эпителиального маркера тимуса, Ly110. J Immunol Methods 297: 265–270.
    42. 42. Нельс М., Кевски Б., Мессерле М., Вальдшутц Р., Шуддекопф К. и др. (1996) Два генетически разделимых этапа дифференцировки эпителия тимуса. Наука 272: 886–889.
    43. 43. Ян С.Дж. (2006) Количественная оценка MHC II на эпителии тимуса: влияние на развитие кортикальных тимоцитов.Int Immunol 18: 729–739.
    44. 44. Андерсон М.С., Венанци Е.С., Кляйн Л., Чен З., Берзиньш С.П. и др. (2002) Проекция иммунологической собственной тени в тимусе белком воздуха. Наука 298: 1395–1401.
    45. 45. Liston A, Lesage S, Wilson J, Peltonen L, Goodnow CC (2003) Aire регулирует отрицательный отбор органоспецифических Т-клеток. Нат Иммунол 4: 350–354.
    46. 46. Учида Д., Хатакеяма С., Мацусима А., Хан Х., Исидо С. и др.(2004) AIRE функционирует как убиквитинлигаза E3. J Exp Med 199: 167–172.
    47. 47. Ян С.Дж., Ан С., Парк С.С., Холмс К.Л., Веструп Дж. И др. (2006) Количественная оценка MHC II на эпителии тимуса: влияние на развитие кортикальных тимоцитов. Int Immunol 18: 729–739.
    48. 48. Surman DR, Dudley ME, Overwijk WW, Restifo NP (2000) Передний край: CD4 + T-клеточный контроль реактивности CD8 + T-клеток к модельному опухолевому антигену. J Immunol 164: 562–565.
    49. 49.Anderson G, Jenkinson EJ, Moore NC, Owen JJ (1993) MHC-позитивный эпителий класса II и клетки мезенхимы необходимы для развития Т-клеток в тимусе. Природа 362: 70–73.
    50. 50. Дженкинсон EJ, Андерсон G (1994) Культуры органов тимуса плода. Curr Opin Immunol 6: 293–297.
    51. 51. Gray DH, Chidgey AP, Boyd RL (2002) Анализ популяций стромальных клеток тимуса с использованием проточной цитометрии. J Immunol Methods 260: 15–28.
    52. 52. Клуг Д.Б., Картер С., Крауч Э., Руп Д., Конти С.Дж. и др.(1998) Взаимозависимость дифференцировки кортикальных эпителиальных клеток тимуса и предопределения Т-линии. Proc Natl Acad Sci U S A 95: 11822–11827.
    53. 53. Klug DB, Carter C, Gimenez-Conti IB, Richie ER (2002) Передний край: независимые от тимоцитов и зависимые от тимоцитов фазы формирования эпителиального паттерна в тимусе плода. J Immunol 169: 2842–2845.
    54. 54. Момбертс П., Якомини Дж., Джонсон Р.С., Херруп К., Тонегава С. и др. (1992) Мыши с дефицитом RAG-1 не имеют зрелых В- и Т-лимфоцитов.Ячейка 68: 869–877.
    55. 55. Derbinski J, Schulte A, Kyewski B, Klein L (2001) Беспорядочная экспрессия генов в медуллярных эпителиальных клетках тимуса отражает периферическое «я». Nat Immunol 2: 1032–1039.
    56. 56. Peterson DA, DiPaolo RJ, Kanagawa O, Unanue ER (1999) Передний край: отрицательный отбор незрелых тимоцитов несколькими комплексами пептид-MHC: дифференциальная чувствительность незрелых и зрелых Т-клеток. J Immunol 162: 3117–3120.
    57. 57. Scollay R, Godfrey DI (1995) Эмиграция тимуса: конвейерные ленты или удачные соусы.Immunol Today 16: 268–273.
    58. 58. Shortman K, Egerton M, Spangrude GJ, Scollay R (1990) Генерация и судьба тимоцитов. Семин Иммунол 2: 3–12.
    59. 59. Рамсделл Ф., Фаулкс Б.Дж. (1990) Клональная делеция против клональной анергии: роль тимуса в индукции самотолерантности. Наука 248: 1342–1348.
    60. 60. Schonrich G, Momburg F, Hammerling GJ, Arnold B (1992) Анергия, вызванная медуллярным эпителием тимуса. Eur J Immunol 22: 1687–1691.
    61. 61. von Boehmer H, Kisielow P (2006) Отрицательный отбор репертуара Т-клеток: где и когда это происходит. Immunol Rev 209: 284–289.
    62. 62. Takahama Y, Shores EW, Singer A (1992) Отрицательный отбор тимоцитов-предшественников перед их дифференцировкой в ​​клетки CD4 + CD8 +. Наука 258: 653–656.
    63. 63. Кишимото Х., Кай З., Брунмарк А., Джексон М.Р., Петерсон П.А. и др. (1996) Различные роли B7 и молекулы межклеточной адгезии-1 в отрицательном отборе тимоцитов.J Exp Med 184: 531–537.
    64. 64. Gotter J, Kyewski B (2004) Регулирование самотолерантности путем дерегулирования экспрессии генов. Curr Opin Immunol 16: 741–745.
    65. 65. Су М.А., Андерсон М.С. (2004) Aire: обновление. Curr Opin Immunol 16: 746–752.
    66. 66. Роби Э., Фаулкс Б.Дж. (1994) Избирательные события в развитии Т-клеток. Анну Рев Иммунол 12: 675–705.
    67. 67. Singer A (2002) Новые взгляды на дилемму развития: модель кинетической передачи сигналов и важность продолжительности сигнала для решения о происхождении CD4 / CD8.Curr Opin Immunol 14: 207–215.
    68. 68. Vukmanovic S, Jameson SC, Bevan MJ (1994) Линия эпителиальных клеток тимуса индуцирует как положительный, так и отрицательный отбор в тимусе. Int Immunol 6: 239–246.
    69. 69. Princiotta MF, Finzi D, Qian SB, Gibbs J, Schuchmann S, et al. (2003) Количественная оценка синтеза, деградации и эндогенного процессинга антигена. Иммунитет 18: 343–354.
    70. 70. Viret C, Barlow AK, Janeway CA Jr (1999) О внутритимическом межклеточном переносе самоопределений.Иммунол Сегодня 20: 8–10.
    71. 71. Klein L, Roettinger B, Kyewski B (2001) Отбор проб дополняющих пулов аутоантигенов стромальными клетками тимуса максимизирует сферу толерантности центральных Т-клеток. Eur J Immunol 31: 2476–2486.
    72. 72. Kouskoff V, Vonesch JL, Benoist C, Mathis D (1995) Влияние положительного отбора на экспрессию RAG в тимоцитах. Eur J Immunol 25: 54–58.

    PPT — Fault Tolerance Some background PowerPoint Presentation, скачать бесплатно

  1. Fault ToleranceSome background Claudio Pinello (pinello @ eecs.berkeley.edu) ЧЕРНОВИКИ

  2. Некоторая терминология • Неисправность является причиной ошибки; • ошибка — это часть состояния системы, которая может вызвать сбой; • сбой — это отклонение системы от спецификации. Адаптировано из: JC Laprie, «Надежность: основные концепции и терминология на английском, французском, немецком, итальянском и японском языках», Springer-Verlag 1992, Название серии: Надежные вычисления и сбой -толерантные системы. ЧЕРНОВИКИ

  3. Пример • Офисный стол • Неисправность лампы накаливания (неисправность) • падение уровня освещенности (ошибка) • Я не могу выполнить работу (неисправность) • если… ЧЕРНОВЫЕ

  4. Одна хорошая идея: Резервирование DRAFTS

  5. Одна плохая идея: Резервирование DRAFTS

  6. Структура • Отказоустойчивость на уровне системы • Избегайте единой точки отказа • Избегайте синфазного отказа (например.грамм. та же ошибка в реплицированном программном обеспечении, все блоки питания выходят из строя при температуре выше 50oC и т. д.) • локализация неисправностей • скрещивание пальцев! DRAFTS

  7. Модель сбоя • Бесшумные отказы • отказы приводят к ошибкам упущения • Ошибки сбоя (отказоустойчивость) • отказы приводят к сбоям: больше никаких данных, никогда! • Не тихие ошибки • ошибки приводят к ошибкам значений • византийские ошибки • злонамеренные атаки, немыслимые ошибки, ограниченные задержки и т. Д. DRAFTS

  8. Обнаружение ошибок • Обычно проверяют наличие ошибок • Тихие ошибки: нет ошибок? • ошибки «упущения»! Легко для синхронных систем, иначе используйте таймауты.• Вопрос: вы заболели в постели. Как узнать, сломан ли дверной звонок? DRAFTS

  9. Обнаружение неисправностей • Обычно проверяют на наличие ошибок • Немолчные неисправности: как узнать, что результат неверен? • например ваш калькулятор вычисляет sin (), как узнать, что он неисправен? • Кстати: сколько сейчас времени? DRAFTS

  10. Обнаружение сбоев • Немолчные отказы: попробуйте голосование • вы можете допустить до n / 2-1 отказов. DRAFTS

  11. Обнаружение отказов • Обычно проверяйте наличие ошибок • Византийские отказы: о боже! • вы не можете доверять людям в чатах… • можете ли вы спросить у них время? • номер счета красного креста для пожертвования? • не могли бы вы спросить их, какое лекарство им принимать? ДРАФТЫ

  12. Византийские генералы • вопрос: «нападение или отступление?» • передача сообщений (устная / письменная) • есть предатели • цель: определить консенсус среди не-предателей ДРАФТЫ

  13. Византийские генералы • Базовый алгоритм (по Lamport et al.) • n раундов устной передачи сообщений • используйте голосование большинством, решайте • Допускает до <1/3 предателей • Если вы можете использовать подписанные сообщения, уменьшенное количество или раунды Все методы требуют ограниченной асинхронности, то есть ограниченных задержек DRAFTS

  14. Какую модель использовать? • Зависит от вашего приложения • Интернет-транзакции? • вероятно византийские • встроенные системы? • обычно достаточно не тихих ошибок, но… • больше сетевых приложений….