Желтый вектор: «Яркий лидер или имитатор?» — Psy8

Содержание

«Яркий лидер или имитатор?» — Psy8

   

В этой статье речь пойдет о представителях желтого вектора. Этих людей, от природы наделенных энергичностью и даром убеждения, нередко путают с Красными, что порой приводит к серьезным проблемам. Но если понимать их бессознательные особенности, то можно не только избежать роковых ошибок, но и получить от общения с ними необыкновенное удовольствие. Ну, обо всем по порядку.

Самый креативный человек

Если в вашей организации начался застой, чувствуется нехватка свежих идей, да и Красный руководитель находится не на пике своей продуктивности, то единственный, кто может вдохнуть новую энергию в общее дело — это Желтый человек. Достаточно сказать ему, что его предложения готовы выслушать, как он погружается в творческий процесс. Именно Желтые — самые подходящие участники для известного креативного мероприятия под названием «мозговой штурм». Ведь только они могут легко соблюдать главное правило «мозгового штурма» — говорить все, что приходит в голову на заданную тему, при этом, совершенно не слушая идеи других участников.

Если рядом присутствуют представители коричневого или оранжевого вектора, которые могут структурировать этот информационный хаос, или Красный человек, способный сразу отделить жизнеспособные идеи, то энергичное общение Желтых заканчивается принятием наилучшего решения из всех возможных.

После этого Красный руководитель выдает всем задания, ожидая от Желтого сотрудника продолжения продуктивной деятельности. Но тот, с воодушевлением приняв на себя всю предложенную нагрузку, отправляется заниматься чем угодно, только не работой. Он хочет есть, курить, пить чай или кофе и миролюбиво общаться со всеми, кто окажется рядом, ведь на уровне бессознательного он считает свою функцию выполненной. 

И Желтый на самом деле прав, так как в психологические функции этого вектора входят: генерация и проговаривание идей, коммуникации внутри фирмы или снаружи, а также создание в любом коллективе хорошего настроения (не всегда рабочего). То есть, Желтый человек способен продуктивно выполнять только ту работу, которая напрямую связана с общением.

Здесь он просто не знает себе равных.

  • Придумать «картинку» великого будущего (не всегда реального) и рассказать всем, что они должны для этого сделать.
  • Отрекламировать товар или услугу так, чтобы у покупателей загорелись глаза.
  • Рассказать подряд несколько десятков анекдотов, причем все к месту, да так, чтобы у слушателей заболели скулы и животы.

Короче говоря, самый оптимистичный и жизнелюбивый, энергичный, добрый и не жадный, главный остряк в любой компании, — вот какой он — Желтый человек.

Но неправильно было бы считать, что Желтые всегда пребывают в прекрасном расположении духа. Они как раз относятся к группе векторов, которым свойственно яркое проявление агрессии (в этой группе еще присутствуют Красные и Черные). Но агрессия по «желтому» типу не физическая, а эмоциональная («оральная»).

Разозленный Желтый человек способен создать своим голосом и угрожающим видом такой напор, что вам может показаться, будто вас действительно отбросило в сторону.

Ощущения от этого «удара» долго не позволяют прийти в себя, чего не скажешь об орущем: он быстро забывает о неприятном эпизоде и искренне удивляется: «Я орал?! Да нет же, я просто громко разговаривал!». Действительно, отходчивость и незлопамятность — его главные черты.

Красный или Желтый?


Если сравнивать внешние проявления разных векторов, то на первый взгляд может показаться, что Желтые люди во многом похожи на Красных. Действительно, обоим векторам присущи энергичность, эмоциональность, устремленность в будущее, быстрое переключение внимания и другие примечательные черты. Но быть Красным во многих жизненных ситуациях намного выгоднее, ведь это лидер, которому все должны подчиняться, тогда как Желтые — напротив, часто слывут болтунами.

Поэтому нередко можно встретить Желтого человека, который пытается произвести впечатление на окружающих и завоевать авторитет, неосознанно имитируя красный вектор. Причем он может это делать настолько искусно, что вокруг него начинают собираться люди, готовые броситься за своим лидером «в огонь и воду».

С похожей проблемой иногда сталкиваются HR-специалисты при отборе сотрудников на руководящие должности. Способный Желтый претендент может на собеседовании так красиво изобразить «красный» стиль поведения, что у специалистов не останется сомнений в его лидерских качествах и прочих достоинствах. Но впоследствии часто оказывается, что нанятый человек не хочет и не может вести за собой команду, если, конечно, не говорить о корпоративных праздниках и прочих веселых мероприятиях. 

Отличить с первого взгляда два эти вектора бывает непросто даже специалисту, поэтому в особо ответственных ситуациях приходится применять дополнительные методы исследования.

Как это выглядит

Узнать Желтого человека обычно не составляет большого труда. Образ жизни — любовь к обильной еде и некоторая леность — часто придает его телу дополнительный объем. Его мимика чрезвычайно богата и нередко дополняется обильной жестикуляцией. Очень подвижные, иногда пухлые, губы могут скрывать характерную особенность желтого вектора — клыки, несколько выступающие из зубной дуги (этот признак удается наблюдать все реже из-за успехов ортодонтов, но если уж вы его заметили — перед вами Желтый наверняка).

Разговаривают эти люди всегда очень эмоционально, их речь красивая и богатая, с множеством поговорок и образных выражений. Иногда они могут позволить себе вставить пару слов из ненормативной лексики, но это будет сделано так красиво и так к месту, что редкий недоброжелатель сможет упрекнуть их в сквернословии.

Аккуратность не входит в число их достоинств, напротив — некоторая небрежность, если не сказать растрепанность, иногда выдает даже преуспевающих представителей этого вектора (кстати, именно поэтому с ними плохо уживаются Зеленые, Оранжевые и Коричневые). 

К характерным жестам можно отнести покусывание и облизывание губ, высовывание языка при разговоре, поглаживание себя по животу. Некоторые Желтые любят свистеть, другие чмокать, третьи — скрипеть зубами. 

Классический Желтый почерк похож на спираль — буквы пишутся почти одинаково, разница лишь в количестве витков.

По секрету всему свету

Непреодолимая страсть к общению не позволяет Желтому человеку молчать даже в самых ответственных ситуациях. Если вы доверили ему личную или корпоративную тайну, то он, конечно же, пообещает хранить ее до конца своих дней. Причем, обещая молчать, Желтый действительно верит в свои силы, но их, к сожалению, часто не хватает.

Будучи от природы благожелательным, он никогда не станет строить козни (по типу фиолетового вектора) и специально передавать кому-нибудь конфиденциальную информацию. Нет, он совсем не злой и не мстительный, просто у него слова иногда опережают мысли, и в результате многократного «случайно сболтнул» вашу тайну скоро будут знать все ваши друзья и враги. Поэтому понятие лояльности для Желтых людей всегда относительное.

То же самое можно сказать о Желтой честности. У этих людей язык не повернется специально соврать во вред кому-то ради собственной выгоды. Они заинтересованы лишь в том, чтобы их долго и внимательно слушали, поэтому преувеличивают и приукрашивают реальные события своей и чужой жизни, а, исчерпав их, переходят на интересное фантазирование. Это как бы не правда и не ложь в одно и то же время.

Совсем другое дело — Фиолетовые. Вот уж кто виртуозно вводит в заблуждение даже самых чутких ко лжи людей (Коричневых, например). Но так как Фиолетовым нельзя высовываться и оставлять следы, они часто используют для продвижения своей информации именно доверчивых Желтых. В результате — кто виноват?

Кстати, такое использование Желтых людей — очень эффективный прием для формирования общественного мнения: если сообщить «секрет» определенному количеству подобных «хранителей тайн», то через несколько дней об этом будут знать практически все.

Общайтесь с удовольствием

Взаимодействуя с Желтым человеком по делу, необходимо хорошо представлять его главные жизненные ценности: питание и общение.

В одном агентстве недвижимости я недавно наблюдал интересную сцену. Очень большой (по объему тела) покупатель с подвижными пухлыми губами долго расспрашивал молодого агента о достоинствах приглянувшегося загородного дома. Его особенно интересовала кухня и место на участке для приготовления шашлыков.

По привычке увлекшись беседой, он внезапно спросил уставшего агента, какое тот любит мясо, на что получил раздраженный ответ: «Я вообще мясо не люблю! Давайте ближе к делу». Интерес клиента был моментально утерян, он задал еще несколько формальных вопросов и, пообещав подумать, поспешно удалился.

Что же произошло? Человека обломали сразу с двух сторон: во-первых, ему не дали вдоволь поболтать на любимую тему, а во-вторых, собеседник заявил о своих прямо противоположных «политических» взглядах. Если вы не хотите потерять шанс увидеть Желтого человека среди своих реальных клиентов, то постарайтесь понять и принять не только его интересы, но и образ жизни (ну хотя бы на время вашего делового общения).

Совершил ли этот молодой специалист по недвижимости глупую ошибку? Скорее всего, нет, и вот, почему. Статистика показывает, что Желтые клиенты — самые активные на этапе переговоров, осмотра и приценивания. Но относительная доля контрактов, заключаемых с такими людьми, чрезвычайно мала.

Желтые просто любят общаться, в том числе, с продавцами, агентами и т.п. Для них визиты в магазин, да еще по несколько раз, — это совершенно не повод для покупки, это их образ жизни. Некоторые опытные продавцы интуитивно чувствуют в покупателях этот потенциал, и быстренько сворачивают их к сути дела. Но такой стиль поведения несет в себе риск потери клиента, ведь Желтые люди все-таки покупают все, что им нужно, и пользуются всеми благами цивилизации. Только покупают они у самых терпеливых продавцов.

Если же вы решите, что лучше потратить свое время на трех реальных клиентов, чем на одного сомнительного, то постарайтесь не перепутать Желтого» покупателя с Коричневым. Последний тоже любит подолгу выбирать товар, советоваться с продавцами, приходить по несколько раз в магазин, но в чем характерная особенность коричневого вектора — он много спрашивает, а не рассказывает, и всегда доводит дело до конца. Поэтому, отняв у вас немало времени, он в итоге совершит-таки покупку.

Возможно ли лидерство?

Чувствуя в себе непревзойденный ораторский дар, многие Желтые люди стремятся найти себя в управлении — не важно чего (фирмы, клуба, шайки). Но, честно говоря, лидерские качества у них выражены слабо. Желтые стараются избегать любых опасностей, они крайне редко рискуют и стремятся к беззаботной комфортной жизни. Они не являются борцами, в отличие от Красных и особенно Оранжевых, а легко и непринужденно плывут по жизни, доставляя радость себе и окружающим. Иногда, добравшись до власти в стране или организации, они чувствуют, что совершили непростительную ошибку, позабыв о своем главном «предназначении» в жизни — получать удовольствие.

 

   

 


Посмотреть по теме:

 

Оральный вектор | Психологические тренинги и курсы он-лайн. Системно-векторная психология

Когда оральный человек говорит, это всегда звучит убедительно. Хотя речь его часто неправильная. Он может обладать неправильной дикцией, коверкать слова, путать ударения, однако то, что он говорит, отпечатывается в голове у всех.

21 394496 20 Июня 2010 в 20:54

Автор публикации: Мария Грибова, специалист в области международного права и международных отношений
Диана Кирсс, семейный врач

Характерные речевые обороты:

  • Не соврешь — красиво не расскажешь!
  • Ради красного словца не пожалею ни мать, ни отца!
  • По секрету всему свету!

Общая характеристика

Численность 5%
Архетип  Индукция — объединение людей через создание единых мыслительных и словесных рядов
Видовая роль В мирное время — разделение пищи на съедобную и несъедобную
В военное время — крик как предупреждение об опасности
Цвет наибольшего комфорта Желтый
Геометрия наибольшего комфорта Овал
Место в квартели Внешняя часть квартели энергии, экстраверт
Тип мышления Вербальный, мыслит говорением

Особенности психики

В первобытной стае оральный человек выполнял две важнейшие функции: в саванне он криком предупреждал стаю об опасности, а в пещере «составлял меню», разделяя пищу на съедобную и несъедобную.

Оральный крик — сигнал для каждого о необходимости спасаться. На привале, когда вся стая спала, он был гарантом безопасности. Получив сигнал от ночного охранника стаи, оральник своим криком издавал звуки, от которых кровь стыла в жилах у всего живого вокруг. Природа наделила его такой способностью не случайно. Лишняя секунда промедления могла обернуться трагедией для всех: стаю могли загрызть хищники либо убить враги. Крик оральника не дает времени на размышление, реакция на него мгновенна — тут же, еще не успев проснуться и понять, что происходит, все оказываются высоко на деревьях, далеко от опасности.

Во время охоты этот крик тоже делал свое дело. Оральный загонщик помогал направить добычу в заранее приготовленную ловушку — испуганное его криком животное теряло ориентиры и мчалось куда глаза глядят.

В мирное время, когда стая находилась в пещере, именно оральник определял, какую пищу можно есть, а какую нельзя, «составлял меню» стаи. По сей день оральные люди становятся лучшими поварами.

В еде оральники не просто чередуют блюда, а ищут все новые рецепты, все новые, самые экзотические вкусы. Процесс приема пищи для них — большое удовольствие. Именно они любят путешествовать с целью попробовать новые блюда, открыть для себя новые продукты, сменить вкусовые впечатления.

Эрогенная зона оральника — ротовая полость и губы — обладает особой чувствительностью. Оральники любят прикасаться к своим губам, любят поговорить, покричать что есть мочи.

Даже во внешности оральника выделяется рот. Чувственный, большой, с порочной верхней губой, на которую и смотреть как-то неудобно, он как будто живет своей отдельной жизнью, все время что-то говорит, шевелится, жует.

Оральный вектор относится к внешней части квартели энергии. Старший брат оральности по квартели — обоняние — во все времена отвечал за выживание стаи. Серый кардинал этого мира, обоняние, и его цепной пес, оральность, всегда работали в общей связке.

Так как выживание стаи — задача первостепенная, то выполнение ее никаким образом не подчиняется требованиям морали, этики, нравственности. Вот почему ни обонятельник, ни оральник не дифференцируют понятия правды и лжи. Для орального человека главное — найти способ вызвать интерес к своему говорению. В этом стремлении рождается ложь — от самой маленькой до самой крупной.

Ложь оральника невозможно отличить от правды. Он на ходу придумывает все несуществующие детали и обстоятельства так, что усомниться в них невозможно.

Когда оральный человек говорит, это всегда звучит убедительно. Хотя речь его часто неправильная. Он может обладать неправильной дикцией, коверкать слова, путать ударения, однако то, что он говорит, отпечатывается в голове у всех.

Оральные люди обладают уникальным вербальным интеллектом. Они сначала говорят, а потом думают. Более того, они начинают понимать предмет только в процессе говорения о нем.

Оральный человек не разговаривает сам с собой. Ему необходимы уши, которые будут его слушать, и слушать внимательно. С другим человеком можно сидеть и отвлеченно кивать головой, а с оральником такое не пройдет. Все ваше внимание должно быть сосредоточено на нем, и он будет добиваться этого самыми разными способами.

Мы научились говорить благодаря оральному человеку. Оральник первым стал обозначать словами отдельные действия и предметы. Причем он делал это особым образом — так, что у всех в головах возникали такие же связи, все начинали мыслить этими же категориями, формировался язык.

Формирование общего языка объясняется способностью оральника к индукции. Это значит, что он не просто говорит, а специфическим образом воздействует на каждого слушателя. Так, что у них начинают выстраиваться общие смысловые ряды, общие связи, появляется общий способ мышления. Часто от его слов возникает ощущение, что «всегда так думал, просто не мог сказать словами».

Величайшие ораторы всех времен — оральные люди — оказывают необычайное влияние на своих слушателей. Ленин сумел поднять страну на революцию. Троцкий молниеносно создал Красную Армию. Гитлер проиндуцировал целый германский народ двинуться за его идеями. Кубинский народ по сей день готов слушать четырехчасовые спичи своего лидера Фиделя Кастро.

Даже не зная языка, не видя самого оратора, чувствуя абсолютную противоположность идеям, которые он проповедует, ты невольно устремляешься к ним. Каждое слово такого оратора, сказанное публично, управляет массами людей и задает им направление движения.

Оральность всегда обслуживает власть. Шут при вожде — оральный человек — всегда имел право говорить «правду». При этом сила оральника настолько велика, что если он становится в оппозицию к власти, к идее или к культуре, то они незамедлительно дают трещину. Он способен превратить любую мысль, любую идею в предмет для всеобщего осмеяния, полностью их дискредитировать.

Про оральника говорят, что он — душа любой компании. Его любят все: жизнерадостный, всегда в приподнятом, даже веселом настроении. Он не выглядит опасным, веселит своими шутками, расслабляет. Балагур и болтун. Он гостеприимен: гости — это и слушатели, и объекты для целования.

За счет таких своих способностей оральник вхож в личное пространство каждого. Не проходит и минуты с момента знакомства, а он уже обнимает вас за плечи и что-то говорит на ухо.

Оральник легко находит общий язык с любым. Но необходимо помнить о том, что это не тот человек, которому стоит доверять свои сокровенные чувства. Не успеете оглянуться, как все ваши самые светлые мысли будут осмеяны и перевернуты с ног на голову.

Также оральнику не стоит доверять ваши тайны. Желая привлечь больше ушей к себе, оральник расскажет их всем, кого встретит, да еще и приврет сверху.

Его называют сплетником и клеветником. Оральные люди — мастера давать клички. Точная, острая, яркая, она прицепляется к человеку на всю жизнь.

В зависимости от уровня развитости оральник становится поваром, юмористом, комментатором, певцом, оратором.

Все самые знаменитые комики, юмористы — обладатели орального вектора: Аркадий Райкин, Михаил Жванецкий, Михаил Задорнов, Максим Галкин, Елена Воробей и многие другие.

Оральные певцы всегда на вершине: Фредди Меркьюри, Алла Пугачева, Григорий Лепс и другие. Из оральных людей со звуком получаются гениальные оперные певцы. А такие оральники, как Владимир Высоцкий, своим пением задают общее мышление целому народу.

При развитом вербальном интеллекте оральник — большой гурман. При неразвитом — обжора. Неразвитый оральник не замолкает ни на минуту, даже во время еды. Он говорит, а еда разлетается в разные стороны — так это выглядит.

Другой способ инициации оральной эрогенной зоны — мат. Оральник испытывает особое удовольствие, проговаривая матерные слова. Знаменитое сексуальное воспитание природой возложено на оральника.

В шесть лет оральный ребенок начинает пробовать мат в своей речи, он первый начинает шутить на «эти» темы и рассказывать неприличные истории. А если ему не дают об этом говорить, именно он пишет матерные слова на заборах и в лифтах. Так его сверстники узнают ответ на вопрос, откуда берутся дети.

Оральные дети очень шумные, говорят без остановки. Поскольку потребность говорить большая, а речевой аппарат еще не развит, он сильно шепелявит, торопится и проглатывает части слов.

Оральник — любимец класса. Он шутит так, что смеются все, включая учительницу. Одноклассники только и ждут от него очередную хохму — смех расслабляет ум, дает приятное ощущение освобождения от всех забот и мыслей.

Оральный ребенок готов говорить все, лишь бы его слушали. Если родители вовремя не направят его, то он может уйти в тотальное вранье. Он будет придумывать самые невероятные истории про соседей, знакомых, одноклассников, родителей.

Если в качестве наказаний за привирания и матерные ругательства орального ребенка бьют по губам, такие удары по сенсору превращают его в заику.

Важно направить в правильное русло активность орального ребенка. Показать ему, про что вам хочется слушать. Чтобы быть выслушанным, он обязательно станет узнавать и рассказывать вам то, что вам интересно.

Его нужно отдать в кружок ораторского мастерства — это разовьет его вербальный интеллект и поможет ему впоследствии реализовать себя. Для него будут хороши любые специальности, связанные с говорением: политик, сатирик, комментатор, ведущий.

Оральник с неразвитым вербальным интеллектом обречен быть кухонным шутом и балагуром всю жизнь.

Загадочный и причудливый оральный вектор, особенности психики оральных людей, особенности их мышления раскрываются во всей красе на тренинге «Системно-векторная психология» Юрия Бурлана.

Подробную информацию об особенностях психики людей с разными векторами, сценариях их взаимоотношений с окружающими можно узнать уже на бесплатных онлайн-лекциях «Системно-векторная психология» Юрия Бурлана. Регистрируйтесь здесь.

Корректор: Наталья Коновалова

Автор публикации: Мария Грибова, специалист в области международного права и международных отношений
Диана Кирсс, семейный врач

Статья написана по материалам тренинга «Системно-векторная психология»

%d0%b6%d0%b5%d0%bb%d1%82%d1%8b%d0%b9 %d0%b2%d0%b5%d0%ba%d1%82%d0%be%d1%80 пнг образ | Векторы и PSD-файлы

  • Мемфис дизайн геометрические фигуры узоры мода 80 90 х годов

    4167*4167

  • аудиокассета изолированные вектор старая музыка ретро плеер ретро музыка аудиокассета 80 х пустой микс

    5000*5000

  • Мемфис шаблон 80 х 90 х годов стилей фона векторные иллюстрации

    4167*4167

  • ма дурга лицо индуистский праздник карта

    5000*5000

  • снежный человек расслабляющий кофе ретро векторная иллюстрация

    5000*5000

  • 80 е брызги краски дизайн текста

    1200*1200

  • Сделано в 1989 году ограниченным тиражом типография премиум футболка дизайн вектор

    5000*5000

  • Крутая голова гориллы векторная иллюстрация

    5000*5000

  • микс ленты ретро кассеты

    1200*1200

  • Бигфут бегущий ретро векторные иллюстрации

    5000*5000

  • Модель буквы м в стиле 80 х

    1200*1200

  • 80 скидка рекламный тег

    1200*1200

  • shiba inu собака ретро векторные иллюстрации

    5000*5000

  • кошка ретро красочные иллюстрации

    5000*5000

  • бумбокс с разноцветными музыкальными нотами

    1200*1200

  • злой волк очки векторные иллюстрации

    5000*5000

  • витаминно минеральный комплекс 3d баннер биологически активных добавок и лекарств

    1200*1200

  • крутой лев в куртке векторная иллюстрация

    5000*5000

  • Мультяшный милый ребенок детство ребенок классики памяти родился в 80 х

    2000*2000

  • бесшовные красочные картины с геометрическими фигурами треугольников Мемфиса и прямоугольника формы фоновой текстуры 80 х годов 90 х годов стиль векторные иллюстрации для упаковки моды текстильной печати

    3967*3967

  • скидка 20 золотых и синих

    2000*2000

  • продажа 80% от предложения

    1200*1200

  • скидка 40 золотых и синих

    2000*2000

  • естественный цвет bb крем цвета

    1200*1200

  • все радужные цвета морщинистый фольги

    1200*1200

  • номер 80 золотая роскошь бесплатный файл eps

    5000*5000

  • Наушники 80 х годов неоновый световой эффект

    1200*1200

  • 80 летний юбилей дизайн шаблона векторные иллюстрации

    4083*4083

  • 80 основных форм силуэта

    5000*5000

  • новые facebook покрытия с red lion и черный и синий полигональной ба

    5556*5556

  • Мемфис бесшовные модели 80 х 90 х стилей

    4167*4167

  • мемфис бесшовной схеме 80s 90 все стили

    4167*4167

  • диско дизайн в стиле ретро 80 х неон

    5556*5556

  • рисованной радио 80 х

    1200*1200

  • игра окончена дизайн футболки

    4000*4000

  • Мемфис бесшовные модели 80 х 90 х стилей

    4167*4167

  • Неоновый эффект 80 х годов Ретро вечеринка арт дизайн

    1200*1200

  • 3d модель надувной подушки bb cream

    2500*2500

  • ретро стиль 80 х годов диско дизайн неон плакат

    5556*5556

  • скейтборд в неоновых цветах 80 х

    1200*1200

  • голова льва ретро очки векторная иллюстрация король лев

    5000*5000

  • Ретро мода неоновый эффект 80 х тема художественное слово

    1200*1200

  • Диско вечеринка в стиле ретро 80 х art word design

    1200*1200

  • Дизайн персонажей моды 80 х годов может быть коммерческими элементами

    2000*2000

  • Мода стерео ретро эффект 80 х годов тема искусства слово

    1200*1200

  • цвет перо на воздушной подушке bb крем трехмерный элемент

    1200*1200

  • в эти выходные только мега продажи баннер скидки до 80 с

    10418*10418

  • 80 летия золотой шар векторный дизайн шаблона иллюстрация

    4083*4083

  • Красивая розовая и безупречная воздушная подушка bb крем косметика постер розовый красивый розовый Нет времени На воздушной

    3240*4320

  • Косметический bb Крем Дизайн Плаката косметический Косметика постер Реклама косметики Плакат

    3240*4320

  • Желтый вектор поп стиль звезды диалоговое окно взрыв элемент

    Применимые группы Для личного использования Команда запуска Микропредприятие Среднее предприятие
    Срок авторизации ПОСТОЯННАЯ ПОСТОЯННАЯ ПОСТОЯННАЯ ПОСТОЯННАЯ
    Авторизация портрета ПОСТОЯННАЯ ПОСТОЯННАЯ ПОСТОЯННАЯ
    Авторизованное соглашение Персональная авторизация Авторизация предприятия Авторизация предприятия Авторизация предприятия
    Онлайн счет

    Маркетинг в области СМИ

    (Facebook, Twitter,Instagram, etc. )

    личный Коммерческое использование

    (Предел 20000 показов)

    Цифровой медиа маркетинг

    (SMS, Email,Online Advertising, E-books, etc.)

    личный Коммерческое использование

    (Предел 20000 показов)

    Дизайн веб-страниц, мобильных и программных страниц

    Разработка веб-приложений и приложений, разработка программного обеспечения и игровых приложений, H5, электронная коммерция и продукт

    личный Коммерческое использование

    (Предел 20000 показов)

    Физическая продукция печатная продукция

    Упаковка продуктов, книги и журналы, газеты, открытки, плакаты, брошюры, купоны и т. Д.

    личный Коммерческое использование

    (Печатный лимит 200 копий)

    предел 5000 Копии Печать предел 20000 Копии Печать неограниченный Копии Печать

    Маркетинг продуктов и бизнес-план

    Предложение по проектированию сети, дизайну VI, маркетинговому планированию, PPT (не перепродажа) и т. Д.

    личный Коммерческое использование

    Маркетинг и показ наружной рекламы

    Наружные рекламные щиты, реклама на автобусах, витрины, офисные здания, гостиницы, магазины, другие общественные места и т. Д.

    личный Коммерческое использование

    (Печатный лимит 200 копий)

    Средства массовой информации

    (CD, DVD, Movie, TV, Video, etc.)

    личный Коммерческое использование

    (Предел 20000 показов)

    Перепродажа физического продукта

    текстиль, чехлы для мобильных телефонов, поздравительные открытки, открытки, календари, чашки, футболки

    Онлайн перепродажа

    Мобильные обои, шаблоны дизайна, элементы дизайна, шаблоны PPT и использование наших проектов в качестве основного элемента для перепродажи.

    Портрет Коммерческое использование

    (Только для обучения и общения)

    Портретно-чувствительное использование

    (табачная, медицинская, фармацевтическая, косметическая и другие отрасли промышленности)

    (Только для обучения и общения)

    (Contact customer service to customize)

    (Contact customer service to customize)

    (Contact customer service to customize)

    Желтый фон формы бесплатные векторы eps ai

    Желтый фон формы бесплатные векторы eps ai

    ключевые слова

    • фон
    • круг
    • круговой узор
    • круги
    • круги и точки
    • круги и точки фон
    • соблазнительный
    • пышные линии
    • точечный узор
    • точки
    • узор точек
    • бесплатный вектор
    • свободный желтый фон
    • шаблон
    • узоры
    • узор в горошек
    • в горошек
    • звезды
    • желтый
    • Желтый фон
    • желтые круги
    • желтые точки
    • желтые точки фон
    • желтые точки обои
    • желтый узор
    • желтые обои
    • eps
    • ai
    • Желтый
    • формы
    • бесплатные
    • векторы

    DMCA Contact Us

    бесплатная загрузка ( eps ai, 951. 7KB )

    Связанная векторная графика

    • Светло-желтый фон многоугольной формы eps
    • Абстрактный желтый волнистый фон формы eps
    • Абстрактные желтые волнистые формы eps
    • Фон с точками и желтыми волнистыми формами eps
    • Бесплатные кристаллы форму линии вектор eps svg
    • Шаблон бизнес-брошюры с желтыми и синими квадратными формами eps
    • Исламский фон с декоративными формами eps
    • Векторные формы этикетки svg eps ai
    • Бесплатная высечка формы вектор svg eps
    • Корпоративная бесплатная визитка psd
    • Зеленые волнистые формы eps
    • Бесплатные кристаллы форму линии вектор eps svg
    • Записать текстовый стиль бесплатно PSD psd
    • Бизнес-брошюра с желтыми формами eps
    • Сердце в форме сердца вектор бесплатно ai psd cdr
    • Желтый фон ai eps
    • Современный шаблон годового отчета с синими и желтыми волнистыми формами eps
    • Желтый и синий геометрический фон eps
    • Желтая брошюра ai
    • Абстрактный красный и желтый изогнутый фон eps ai
    • Синие волнистые формы на прозрачном фоне eps
    • Бесплатный вектор Versace svg eps
    • Бесплатная творческая визитка psd
    • Темный фон шестиугольной формы eps
    • Бесплатная корпоративная визитка psd
    • Фон с волнистыми золотыми формами eps
    • Бесплатные цветочные векторы svg ai
    • Желтый щит eps ai
    • Фиолетовый фон с волнистыми формами eps
    • Бесплатные векторные желтые стикеры с канцелярской кнопкой eps ai cdr
    • Черно-желтая визитка eps
    • Абстрактные современные волнистые формы eps
    • Синие волнистые формы на прозрачном фоне eps
    • Желто-черная визитка eps
    • Желтый и синий геометрический фон eps
    • Зеленая и желтая волнистая форма бизнес брошюры флаер макет шаблона eps
    • Бесплатный макет бумажного пакета psd eps ai svg
    • темная визитка с желтыми формами eps
    • Красочная мандала с цветочными формами eps
    • Круглая золотая форма eps
    • Векторные формы значка eps ai
    • здравоохранение и медицинское образование с гексагональной геометрической формой eps
    • Волнистые формы на прозрачном фоне eps
    • Желтый абстрактный фон ai
    Загрузи больше
    • Contact Us

    Воздействие Желтого

    Про цвет написано очень много, поэтому я не буду углубляться в этимологию и общедоступные факты, а просто выскажу свои ассоциации, анализируя кадры из фильмов.

    Недавно соседка принесла нам желтый арбуз. Говорит «он слаще, чем красный», но мне так не показалось. Однако чем больше я смотрел на его желтую мякоть, тем он становился вкуснее, то есть сам цвет ягоды улучшал её вкус.

    Итак, желтый — самый яркий цвет, его периферийное видение в 2,5 раза выше, чем, например, у красного. Считается, что в ярких и теплых тонах это цвет счастья и просвещения, Бога и творчества, солнца и лета, мудрости, знания, отдыха, радости, оптимизма и воображения; а в темных и холодных оттенках — трусости, предательства, эгоизма, безумия, нечестности, зависти, жадности, обмана, опасности и физической болезни, например, желтухи, малярии. Последняя ассоциация верна с научной точки зрения — источниками желтых пигментов в основном являются токсичные металлы: кадмий, свинец, хром. 

    Желтый цвет редко используют в интерфейсах и, например, в бытовых приборах. Любопытно, почти все в мире считают, что желтый — цвет счастья, но при этом сила желтого не воспринимается на бытовом уровне. Это такой цвет, который мы все любим, но с которым не хотим жить. Кстати, Яндексом я именно по этой причине и не пользуюсь.

    Понятно, что у каждого человека ввиду личного опыта и переживаний свое личное восприятие цвета и сочетания цветов. Однако есть закономерности, которые действительно работают и вызывают определенные эмоции, тем самым помогая авторам правильно донести свою мысль.

     

     

    В вашем гардеробе есть желтые оттенки? У меня есть желтые джинсы, но я их мало ношу. Все потому, что они создают болезненный образ и ассоциируется с болезнью — как физической, так и умственной (не зря сумасшедшие дома называют «желтыми»). 

    Но желтый очень идет чудаковатой Коралайн из фильма Генри Селика — её плащ и синие волосы контрастируют с окружающим реальным миром. 

    Вы заметили, как по сюжету фильма меняется девочка? С детской точки зрения, трудоголизм родителей эгоистичен, Коралайн их не понимает и ненавидит, все что её окружает (хотя тут, конечно, основания есть — слишком уж сер пейзаж и обстановка вокруг). Изменить её отношение может только приятно-теплый фактурный Другой мир и «по-настоящему любящая» мать. В результате в конце фильма мы видим полностью преобразившуюся героиню.

    В стремлении к тотальному веселью и счастью Коралайн похожа на Радость из Головоломки: обе они хотят испытывать только положительные эмоции, пока не повзрослеют и не поймут важность других чувств.

    Еще один персонаж, желающий обезопасить свой мир от тревог и «плохих чувств» — Марлин. Точно также, как Радость не хотела отпускать шары с радостными воспоминаниями и весь фильм старалась вернуть их на место, Марлин не хотел отпускать Немо от себя ни на шаг. Желтое мягкое жилище рыб — символ спокойствия, равновесия и уюта.

    Кстати, интересно, что практически во всех солнечных фильмах Пиксара наряду с теплыми приятными оттенками появляются отталкивающие грязные.

    Вспомните сцену из Истории игрушек 3, когда выбросили Латсо, клоуна и малыша: все окрашивается в жухлый желтый цвет, вызывающий грустные чувства.

    А в этой сцене из Головоломки доминирует темно-желтый, показывающий кризис, в котором оказался персонаж.

     


    Посмотрите, как плавно меняется цвет от внутреннего ярко-фиолетового мира девочки к реальному, в котором она решается сбежать из дома. Это сделано очень плавно и совершенно незаметно для глаза зрителей: сначала сцена полностью фиолетовая, потом во втором слева кадре мы видим немного желтых оттенков, фиолетовых становится меньше и после этого вся сцена заполняется грязно-желтым.

    Если вы подумали: «при чем тут желтый цвет? это же зеленый!» — вот пипетка из фотошопа:

    Ну и для сравнения два цвета: желтый с добавлением черного и зеленый с добавлением черного — Пиксар использует как раз первый вариант.  Желтый — страшно боится темных оттенков, например, при добавлении черного, он сразу становится болезненным, желто-зеленым. Но Пиксар осознанно выбирает именно этот оттенок, во многом присущий хоррору.

    Посмотрите на сцену из Университета Монстров, в которой неожиданно для зрителя Майк одерживает победу над лучшими страшилами университета. Сначала радужные цвета раскрывают мир Майка во все стороны, в этот миг все окрашивается победой зеленого. Но как только зрители расходятся, гамма тускнеет, коричневый манекен отравляет атмосферу кадра, и мы узнаем правду. Дальше все становится еще хуже — гамма меняется на черно-белую: выбеливающий свет от фонарика, красный свет от полицейской машины. В итоге все сводится к выяснению взаимоотношений между героями.  

     


    Сидя у реки в пустоте практически в отсутствии цвета, главные герои мирятся: Салли наконец находит друга, Майк находит себя, и вместе они совершают невозможное, пугая взрослых — из темноты поднимаются красные индикаторы, свет озаряет желтые капсулы, переполненные криками взрослых. Происходит взрыв цвета, света и эмоций у зрителей.

    Вспомните сцены, когда «франкинштейны» выходят подружиться с Вуди; когда Марлин осознает, что его сын погиб; когда Вуди оказывается на свалке — в моменты кризиса всегда появляется грязно-желтый.

    Кстати, именно этот оттенок желтого с переходом в коричневый — Pantone 448C — был признан самым непривлекательным по результатам исследования, проведенного компанией GfK Bluemoon. ​


    Грязно-желтый также основной цвет в Прометее Ридли Скотта. Именно из-за содержания желтых, болезненных оттенков и того, как этот цвет медленно влиял на мое восприятие фильма, он так запомнился мне.

     


    Посмотрите, какие тонкие оттенки цвета. Выбеленные цвета присутствуют везде, этот пастельный желто-зеленый, пиницилиновый цвет, создает безжизненное ощущение. Каждый кадр в фильме стерильный, холодный, как будто обработанный хлоркой.

    Сочетание плотного синего и едкого желтого проходит через весь фильм, становясь главным средством выразительности фильма. 

    Самое интересное в палитре начинается здесь. Мне кажется, подсветка шлемов разработана не случайно и несет смысловую нагрузку. Желтый, выбранный для этого фильма, не тот приятный, уютный, теплый желтый, который мы так любим. К примеру, посмотрите на почти такую же подсветку в Тихоокеанском Рубеже:

    Дизайн почти такой же, но оттенок теплый, медовый, дающий совсем другое ощущение — некой безопасности происходящего.

    Желтый в Прометее  ядовитый и радиоактивный, и тот факт, что он светит на шею главных героев, добавляет очень странное удушающее чувство, как-будто заражающее каким-то вирусом. Мы буквально чувствуем все на себе, на своей собственной шее.

     


    Все герои в опасности, которую еще ни разу не показали, но мы уже заражены ею. Даже в небольших паузах цвет не дает нам покоя, он только набирает силу. Он «отравляет» ваше подсознание.  

    Тот же оттенок использован в Матрице: в сочетании со стерильными холодными, больнично-кафельными стенами он дает ощущение нездорового сна.

    В Городе Грехов практически все персонажи изуродованы и, чтобы выделить главного мерзкого злодея, авторы фильма используют именно желтый цвет. 

    —  

    Если говорить о гармоничных медовых оттенках, рождающих чувства тепла и уюта, в первую очередь у меня на ум приходят фильмы Уэса Андерсона. Обилие желтого проходит сквозь все фильмы режиссера, исключения составляют только Бутылочная ракета, Академия Рашмор и Отель «Гранд Будапешт».

     

     

    В Бесподобном Мистере Фоксе и Поезде на Дарджилинг желтый вообще главный цвет фильма и основная гамма держится на нем. Да и в Стиве Зассу достаточно желтого.

     

     

    Желтые оттенки Уэса всегда теплые и приятные, они не только помогают погрузить зрителя в уютную атмосферу, но и поддерживают юмор, держащийся на плоской и идеальной композиции:  дети ведут себя как взрослые, как в Королевстве полной Луны, а взрослые ведут себя как дети — Семейка Тененбаум, Водная жизнь.

    Особенно символичен желтый в Семейке Тененбаум: Ричи долго добивался близости со своей сводной сестрой, а под конец фильма увидел её в своей же палатке уютнейше-медового цвета, подчеркивающую его ощущения на данный момент.

    Палатка в фильмах Андерсона сродни символу любви — в Королевстве полной луны Сэм и Сьюзи тоже скрываются в желтом убежище.

    Фильмы Уэса настолько пропитаны добром, что даже когда теплое уютное жилище сломано, фильм не теряет волшебства ни на миг — желтый подчеркивает детство и инфантильность в каждом кадре.

    Меня в свое время поразило, что желтый — самый яркий из всех цветов спектра. Он работает в полную силу и проявляет свою суть только в светлых тонах, его призвание — быть светом.

    Для сравнения я взял основные цвета и разложил их от белого до черного: посмотрите, у каждого цвета есть определенная фаза яркости, в которой он выражается в своей полной насыщенности. Следующая картинка максимально уродлива, но она выполняет чисто научную цель, поэтому отнеситесь с почтением к радуге.

    Как видите, вся суть желтого проявляется в светлых оттенках, а синего — в темных; при этом интересно, как много оттенков держит желтый в темных тонах и как мало темных оттенков у синего.  

    В Маленьком принце холодному пространству взрослой жизни противопо-ставляется теплый текстурный мир Авиатора, рисунков автора, дюн в пустыне, солнца, бумаги и звезд. 

     

    Желтый цвет, который захватывает наше внимание больше, чем любой другой, он — цвет подсолнухов и лимонов, яичных желтков, канареек и пчел. ​

    У Эдварда из Крупный рыбы на лице кровь, но он улыбается, а задник из нарциссов придает атмосферу спокойствия и радости. При взгляде на этот кадр невозможно воспринимать происходящее как драму, сразу становится понятно, что в центре тут не драка — настолько желтый цвет отвлекает внимание.

    Таинственный лес — еще один пример сочетания красного с желтым: в фильме цвета присвоены противоборствующим силам. И если с выбором красного в роли антагонистического все понятно — он нас волнует, вызывают тревогу и агрессию — то с желтым, на первый взгляд, не все так очевидно. Почему вместо него не использовать успокаивающий голубой или безопасный зеленый как противоположность красному?​

    Психологи утверждают, что желтый цвет — самый счастливый цвет спектра, он внушает оптимизм, спокойствие и радость. Но также желтый вводит нас в состояние ожидания, как светофор, он возбуждает нашу нервную систему и заставляет мозг работать.  В союзе с красным он символизирует импульсивность и уничтожение, а также становится «сильнее», благодаря чему желтые плащи героев воспринимаются как реальная защита от монстров.

     

    На фоне больших и масштабных фильмов, использующих бежевую палитру в качестве основной, мозг жаждет напиться цветом, именно поэтому желтый цвет стал частью успеха Стражей Галактики.

    Здесь помимо желтого используются все остальные цвета радуги и даже плохие парни раскрашены в ярко-голубой конфетный цвет.
     


    Желтый в Стражах — символ перемен и перерождения: желтые тюремные костюмы, тонущий в желтой спинномозговой жидкости Дракс, желтые споры Грута и желтая сеть, скрепленных истребителей Корпуса Нова.  

    Ну и как же без Медмакса Фьюри Роад? Если режиссер Стражей хотел добавить больше яркого цвета в фильм, то Джордж Миллер буквально выкрасил весь фильм до предела, фильм утолил жажду ярких оттенков на несколько лет. Очень сочно, очень. 

    Солнце. Зной. Агония. Нет воды. Еды тем более. При просмотре фильма физически рождается жажда — огонь, песок, обезвоживающие вихри.  

    Другая погоня и совершенно другое восприятие желтого — базового цвета юмора. Не забудьте заценить гениальную композицию кадра — как бы этот желтый слизень ни торопился, все линии тянут его обратно.

     

    Другой, классический пример использования желтого в жанре комедии— Симпсоны. Так как фиолетовый — комплиментарный желтому цвет, авторы часто используют его для фона.  
     

     

    Помните Шаолиньский футбол? Если нет, то срочно смотрите.

    В фильме все футболисты играют в желтых халатах. И хотя, как известно, желтый пояс — низший в боевых искусствах, команда, конечно же, побеждает в конце.  

    В фильме Грязь желтый уместно подчеркивает нелепость: свитер мужчины перекликается с цветом льва на картине, образ которого совершенно не соответсвует характеру персонажа.

    В Типа крутых легавых напарники, конечно, не весь фильм ходили в желтой форме, но для клоунады цвет отлично работает.

    А Чак Рассел в Маске сделал очень крутую вещь относительно колористики главного героя: его лицо неприятного желто-зеленого цвета играет на контрасте с одеждой теплого желтого оттенка — похожее ощущение возникает при виде любимой еды в непривычном цвете: вроде хочется съесть, но сам цвет отбивает желание.  
     

     

    Чтобы создать приятную для глаз картинку, и при этом управлять пульсом зрителей в зале, нужно обладать высоким профессионализмом в знании цвета и воздействии цвета на психологию людей. Именно поэтому всегда интересно наблюдать за использованием оттенков не по назначению и как бы не к месту. 

    Например, если взять приятный медовый цвет, но поставить рядом с черным, он тут же воспринимается как агрессивный или ядовитый. Тарантино уже дважды использовал пчелиный раскрас для своих персонажей. 
     


    В Троне силы антагонизма подчеркнуты огненным желтым, а силы добра — чистые и холодные.

    Если разобраться, логически выбор сделан правильно: бело-голубой выступает как цвет мудрости и спокойствия, а желто-красный — цвет агрессоров и огня, но из-за большого количества приятного желтого их хочется поменять местами.  

    Отличный пример использования желтого в обратном значении — Бэтер колл Соул. Желтый в Соуле везде: машина, предметы одежды, интерьер, мебель, освещение, и несмотря на то, что это цвет радости, и сам Соул любит веселиться, сериал далек от жанра комедии. Если вдруг вы уже видели это видео, можете посмотреть еще раз, я добавил кадры из второго сезона.

    Желтый тут используется как раз не к месту: вместо того, чтобы рождать радость и надежду в фильме, он используется как сарказм — все неудачи главного героя облачаются в цвет смеха.

    Похожее несоответствие можно увидеть и в Маленькой мисс Счастье. Отчасти лента похожа на фильмы Уэса, но не вызывает такого же расслабленного восприятия — ребенок в качестве главного героя, частое использование желтого, но все это в перевернутом значении. 

    Здесь цвет пытается поддержать юмор, как в Бэтер колл Соул, но даже главный символ — желтая машина — вместо того, чтобы стать неким убежищем (как, например, палатка), превращается в главное место споров и кризисов.
     

    —  

    Каждый цвет содержит в себе тысячи оттенков и каждый оттенок содержит в себе определенную мысль или её противоположность, и, чтобы автору правильно передать мысль через цвет, всегда нужно помнить, что выбор контекста важнее выбора определенного цвета.

    На этом про желтый цвет все, о каком цвете следующем писать? А то скриншотов гигабайты.

    Авторы желтой статьи: Миша и Надя Петрик.

    23 Сентября 2016

    «Символика желтого цвета в искусстве и литературе»

    Оглавление

    Введение………………………………………………………………………………………………3

    1. Что такое цвет………………………………………………………………………………………4

    2. Что символизирует желтый цвет в культуре и литературе………………………………………4

    3. Цветовой мир в романе М. А. Булгакова «Мастер и Маргарита»………………………………6

    4. Желтый цвет в искусстве………………………………………………………………………….7

    Заключение…………………………………………………………………………………………..9

    Список использованной литературы……………………………………………………………10

    Приложение…………………………………………………………………………………………11

    Введение

    Символика цвета имеет давнюю историю. Люди с незапамятных времен придавали особое значение чтению «языка красок», что нашло отражение в древних мифах, народных преданиях, сказках, различных религиозных и мистических учениях. Цветовая символика имеет древнейшее происхождение, возникнув в те времена, когда человек научился добывать, и использовать природные краски. С тех пор цветовой символизм прошел большой путь. Традиции цветовой символики сейчас, во многом, утеряны особенно в индустриальных странах, в которых преобладает утилитарное отношение к цвету. С момента своего возникновения цветовой символизм самым тесным образом был связан с магией и религией. Роль цвета в религиозном сознании людей, особенно древних, велика. Как показывают археологические, исторические и этнографические исследования мистические представления человека и цветовая символика были тесно взаимосвязаны.

    Актуальность данной работы обусловлена интересом к символике желтого цвета в литературе искусстве

    Цель работы:

    — Выяснить что значит цвет.

    — Узнать что символизирует желтый цвет

    -Дать представление символики желтого цвета в романе М.А. Булгакова «Мастер и Маргарита» и в живописи известных художников.

    Задачи:

    1.Ознакомиться с символикой цвета.

    2.Изучить и проанализировать цветовой мир романа «Мастер и Маргарита»

    3.Выяснить, что значит желтый цвет в искусстве (живописи)

    Объектом исследования является символика желтого цвета.

    Методы исследования:

    Для решения поставленных задач используются наблюдение, описание. Сбор материала проводился посредством методов анализа и сравнения.

    Материалом исследования стало произведение М.А. Булгакова «Мастер и Маргарита», живопись известных художников.

    1.Что такое цвет.

    Что такое цвет? Какова его природа? Что представляет собой окраска предметов? Почему одни предметы синие, другие красные, а третьи зелёные? Если посмотреть вокруг, то двух предметов одинакового цвета мы практически не найдём. Разнообразие цветовых оттенков бесконечно. Ньютон выделил семь цветов в спектре: красный, оранжевый, желтый, зеленый, голубой, синий, фиолетовый. Ещё один цвет — пурпурный — причислен к классификации, как образованный смешением двух крайних цветов спектра — красного и синего. Спектральные цвета составляют очень небольшую часть видимых человеком оттенков. Человек с нормальным цветовосприятием способен различать около десяти тысяч цветовых оттенков. [1]

    Изначально цвет использовался в качестве простого связующего средства между объектами, затем — знака-символа и в последнее время — системы языкового характера. При определении смысла и значения цвета всегда учитывались конкретные исторические условия. Сначала человек почувствовал, что горящие и нагретые предметы краснеют, далекие предметы в воздушном пространстве голубеют, а позже понял, что из всех цветов синий — «самый далекий», а красный — «самый теплый». Становление цветовой знаковой системы протекало неразрывно с развитием художественной культуры, поэтому проанализировать ее и особенно понять символическое значение цвета изолированно от человеческой истории и культуры невозможно. Человек воспринимает информацию в цвете на основе своего опыта, культуры и образования в условиях жизни людей отдельной страны или региона. [2]

    В данной работе мы подробнее остановимся на символике желтого цвета. Мы увидим, насколько разнообразны его оттенки, попытаемся разобраться в основных символических значениях, которые несёт в себе данный цвет.

    2. Что символизирует желтый цвет в культуре и литературе

    Жёлтый цвет имеет следующие значения.

    1. Состояния, связанные с позитивной энергетикой: веселье, разрядка напряженности, радость, праздник, игра, красота.

    Арабский поэт IХ века воспевает красоту женщины, одетой в желтое платье:

    Платье желтое надела — и очаровала нас

    И пленила, покорила множество сердец и глаз.

    В поэме Амира Хосрова Дехлеви «Восемь райских садов» главный герой — шах посещает желтый дворец в воскресенье — самый радостный день недели. В поэме воспевается хвала желтому:

    Цвет благороднейший! Такого цвета

    Ланиты у влюбленных без ответа.

    Нас от недугов золото целит,

    Поскольку цвет шафрана в нем разлит.

    и солнце, выплывая из-за гор,

    Окрашивает в золото простор.

    И жирный плов на блюде пахнет пряно,

    Приправленный улыбкою шафрана.

    2. Магическое воздействие — противопоставление смерти и бессмертия, счастье в браке, лечение болезней, вызывающих желтизну тела, знак земли и женского начала.

    В древнем Китае обитель мертвых называли «Желтыми ключами», но желтый журавль был аллегорией бессмертия. В Индии новобрачная покрывает свои руки желтым для того, чтобы обеспечить себе счастье и единодушие в браке.

    Лечение желтухи в древней Индии: основа магической операции состояла в том, чтобы прогнать желтый цвет с больного на желтые существа и предметы, к которым желтый цвет пристал, как, например, солнцу. (Обряд сопровождался заклинаниями, отсылавшими «желтуху на солнце»). Такая же лечебная сила приписывалась и одной желтой разновидности галок и особенно ее громадным золотистым глазам. Считалось, что если пристально вглядеться в ее глаза и птица ответит таким же взглядом, то человек будет вылечен — болезнь перейдет на птицу.

    В Греции этот недуг и сейчас называется «золотой болезнью» и ее излечению якобы помогает золотой амулет или кольцо.

    3. Знак отличия в обществе — одежда и головной убор царя, ритуальная одежда священника, знаки царской и жреческой власти — жезл, держава, крест. Здесь желтый цвет явлен на драгоценных фактурах и материалах — таких, как золото, шелк, парча, камни-самоцветы. Так, главный китайский бог-демиург (ремесленник) Хуан-ди назывлся «Желтый император».

    4. Язык общения с богами и духами — слава, божественная власть, атрибут Аполлона, Зевса, китайских императоров, римских триумфаторов, жертва Аллаху, статуи Будды и его святых, одежда буддийских проповедников и монахов; свет, солнце, Бог, мудрость, праведность.

    «И вот сказал Муса своему народу: Вот, Аллах приказывает вам заколоть корову <…> Она — корова желтая, светел цвет ее, радует она смотрящих». [3]  

    «Золотые яблоки в серебряных прозрачных сосудах – слово, сказанное прилично.

    Золотая серьга и украшение из чистого золота –  мудрый обличитель для внимательного уха». (Библия, Ветхий Завет, «Книга Притчей Соломоновых»).

    5. Язык ритуалов — праздники, обряды, церемонии.

    Индийский обряд посвящения в ученики: в ночь накануне церемонии мальчика намазывали желтым порошком и на его чуб надевали серебряное кольцо. После этого ему приказывали провести всю ночь в абсолютном молчании. Это был мистический обряд, который приготовлял мальчика ко второму рождению. Желтый порошок символизировал нахождение в утробе, а абсолютное молчание означало, что ребенок снова как бы стал бессловесным зародышем.

    В Китае праздник Земли справляли в желтых одеждах. На алтаре Земли — янтарь медового оттенка.

    В Древнем Египте желтый цвет символизировал бога Ра и пустыню.

    Тибетские божества («властелинов земли») размещали на круге, ориентировали по странам света и обозначали животными. В центре круга помещали желтую (золотую) обезьяну, на севере — белую черепаху, на юге — голубого дракона, на западе — красную птицу, на востоке — белого тигра.

    Среди цветов ислама было три основных. Первым основным цветом в исламской символике считается белый – цвет приобрел собирательное значение всего хорошего и наилучших качеств. Второй основной цвет — желтый как символ блестящего света, солнца, золота, нетления, радости. третий основной цвет — красный, причастный к свету.

    6. Знаки и сигналы — предостережение, предупреждение, желтое с черным — знак запрета, желтый в виде золота — знак дороговизны и высокого качества товара.

    Желтая карточка — недоверие, предупреждение; «желтая акация» в языке цветов означает уход любви.

    «Желтый билет» — удостоверение личности продажных женщин.

    В Англии ХIХ века — желтые шляпы несостоятельных должников.

    7. Негативная символика желтого и золотого — грех, предательство, продажность, безумие, увядание, грусть, тление, отчаяние, болезнь.

    Общеизвестны такие выражения, как желтая пресса, Желтый дом; «Йеллоу Джек» — флаг, который поднимали на кораблях в знак карантина. В средневековой Испании одевали в желтое еретиков, сжигаемых на кострах инквизиции.

    Иуду Искариота изображали в желтом плаще, как предателя. Во Франции желтый цвет был знаком обманутых мужей, рогоносцев.

    Ряд негативных значений желтого связан с цветом осенней умирающей листвы и грустным настроением по поводу конца лета.

    Японские стихи, Манъёсю:

    Ветвь, что сломал для тебя, пожелтела;

    Весна, а на ней уже осени след!

    Анна Ахматова:

    Круг от лампы желтый, шорохам внимаю.

    Отчего ушел ты? Я не понимаю…

    От любви твоей загадочной,

    Как от боли, я кричу,

    Стала желтой и припадочной,

    Еле ноги волочу…

    Сергей Есенин:

    Не жалею, не зову, не плачу,

    Все пройдет, как с белых яблонь дым.

    Увяданья золотом охваченный,

    Я не буду больше молодым…

     

    Снова пьют здесь, дерутся и плачут

    Под гармоники желтую грусть…

    «Мавры различали противоположные символы по двум различным нюансам желтого цвета. Золотисто-желтый означал «мудрость» и «добро», а блекло-желтый — предательство и обман…»

    «В геральдике золото обозначает любовь, постоянство и мудрость, а желтый цвет — противоположные ему качества: непостоянство, зависть…». [4]

    Так, примеры и негативной, и положительной символики желтого цвета так многочисленны, что каждый сам может дополнять этот список.

    3. Цветовой мир в романе М. А. Булгакова «Мастер и Маргарита»

    Есть такие художники слова, чьи книги читать не просто, для них нужен особенный настрой. Одним из таких писателей является М. А. Булгаков. Михаил Афанасьевич Булгаков — русский писатель, драматург, театральный режиссёр и актёр, автор повестей, рассказов, фельетонов, пьес, инсценировок, киносценариев и оперных либретто. Михаил Булгаков – один из самых интересных и загадочных писателей двадцатого столетия. Есть у этого писателя роман, который по-особенному притягивает к себе, берёт в плен миллионы читателей всего мира. Это вершинное произведение М. Булгакова, над которым он работал с 1928 года до конца жизни. Роман, который писатель неоднократно редактировал. Роман, имевший самые разные варианты названий, такие как «Черный маг», «Жонглер с копытом», «Гастроль», «Великий канцлер», «Сатана», «Вот и я», «Копыто консультанта», «Князь тьмы». Сейчас этот роман известен нам под названием «Мастер и Маргарита».

    Это произведение наполнено фантастическими элементами, которые, на первый взгляд, не имеют никакого отношения к реальным проблемам. Но каждая деталь, даже самая несущественная, несёт в себе какой-то скрытый смысл, позволяющий понять произведение, его идею. Одной из таких символических деталей является цветовая символика. Использование символики – один из способов Булгакова донести до читателя свои мысли, видение мира. Символы очень интересны, потому что в жизни с ними сталкивается каждый из нас. К тому же, они позволяют взглянуть на мир с другой позиции, немного отойти от обыденных взглядов на вещи. Цвета многогранны в применении: они могут сообщать читателю некоторые мысли, передавать настроение, ощущения. В романе «Мастер и Маргарита» не раз встречаются синий, жёлтый, золотой, серый, зелёный, чёрный и красный цвета. Мы подробнее остановимся на желтом цвете.

    Нами были выписаны все фрагменты текста романа «Мастер и Маргарита», в которых встречается упоминание о желтом цвете. В приложении к работе приведена таблица, в которой представлен контекст с упоминанием исследуемого цвета и символическое значение, которое несёт в себе желтый цвет.

    Подытожив, можно сделать следующие выводы.

    1. Кроме самого желтого, писатель приводит следующие разновидности этого цвета – рыжий и золотой.

    2. Яркий, живой, солнечный оттенок желтого может символизировать душевную теплоту, открытость, искренность, но встречается очень редко.

    3. Наиболее часто желтый цвет в произведении отождествляется с опасностью, символизирует брошенный вызов, тревогу, болезненность. Может символизировать выморочность, духоту жизни, невозможность дышать полной грудью, загнанность, печаль, назойливость. Рыжий также символизирует опасность, тревогу. Золотой оттенок может выражать как дороговизну, обман, власть денег, так и качество предмета, святость, мудрость и праведность.

    4. Желтый цвет в искусстве.

    Цвет – душа живописи. Далее мы рассмотрим несколько картин, в которых встречается и играет важную роль желтый цвет.

    1. «Маэста» – Дуччо ди Буонинсенья, 1308-1311 гг.

    Картина итальянского художника. Насыщена золотым цветом, который символизирует святость, непорочность.

    1. «Благовещение» – Симоне Мартини, 1333 г.

    Эта алтарная картина была создана Симоне Мартини совместно с Меммо Липпи (1291-1356) для капеллы святого Ансано в Сиенском соборе. По сторонам от сцены Благовещенья изображены святой Ансано и святая Джулитта. От архангела Гавриила, принесшего Богоматери благую весть, исходит начертанная на золоте фраза: «Радуйся, Благодатная! Господь с Тобою!». [5]

    1. «Портрет молодой венецианки» — Альбрехт Дюрер, 1505 г.

    Образ молодой венецианки отличается необычайной яркостью и лиризмом. Дюрер сумел запечатлеть нежность юности и при этом уловить неповторимый, свойственный венецианской атмосфере, дух праздничности. Примечателен контрастный колорит картины: тёплые цвета – золотистые волосы девушки и расшитое золотыми нитями платье – резко выделяются на тёмном, почти чёрном фоне.

    1. «Страшный суд» — Лука Лейденский, 1526-1527 гг.

    Считается подлинным шедевром Луки Лейденского этот знаменитый триптих, заботливо сохраненный от всех иконоборческих потрясений XVI в. самими лейденцами, которые вскоре осознали исключительность этого алтаря. Сцены Рая (на обороте — апостол Петр) и Ада (на обороте – апостол Павел) расположены по сторонам от центральной сцены «Страшного суда», написанную в светлых тонах и оживленную большими зонами белого света. Немногочисленные персонажи на первом плане изображены с большим вниманием, взаимосвязь между различными группам подчеркнута противопоставлением светлых тел и темно-коричневой земли.

    1. «Триумф смерти» — Питер Брейгель. 1562 г.

    Полотно «Триумф смерти» напоминает человечеству о неотвратимости смерти. В правом углу показан стол, окруженный пирующими и предающимися разврату молодыми людьми; их поджидает смерть. В левом углу изображена лежащая фигура в короне, в алой мантии на горностаевом меху; но смерть, уже предъявившая на него свои права, теперь интересуется лежащим рядом с королем золотом, добытым обманом и стяжательством. Смерть у Брейгеля — кара за грехи, она настигает человека в бою и на пиру, во время любовного свидания и в поле за работой. А фоном всему этому — страшный адский пейзаж земли, превращенной людьми в пустыню. Современные исследователи считают, что Брейгель умел создавать очень откровенные произведения с очень актуальным смыслом, скрытым под традиционными сюжетными мотивами. [7]

    1. «Подсолнухи» — Винсент ван Гог, 1888 г.

    В картинах, посвящённых подсолнухам, Ван Гог словно заново открывает для себя жёлтый цвет – в нём так много жизнерадостности, открытости и энергии. Он наносит краску на холст объёмными мазками. Со временем подсолнух станосвится своеобразным символом в творчестве Ван Гога.

    1. «Ночное кафе» — Винсент Ван Гог, сентябрь 1888 г.

    Ванн Гог: В «Ночном кафе» я попытался изобразить место, где человек губит самого себя, сходит с ума или становится преступником. Я хотел выразить пагубную страсть, движущую людьми, с помощью красного и зелёного цвета».

    Картина была названа одним из шедевров Ван Гога и получила высокую оценку критиков. В отличие от импрессионизма, в этой картине художник не восхищается красотой природы или состояния, Ван Гог передает свои эмоции и чувства, в том числе и с помощью цветового решения. Картина проникнута теплыми цветами с преобладанием жёлтого, который передает душную и прокуренную атмосферу заведения. Зелёный цвет потолка и бильярдного стола скорее передает болезненное ощущение, дополняет картину обилие красного — цвета тревоги и страсти. Стиль, в котором выполнена эта работа Ван Гога, позже будет назван экспрессионизмом.[8]

    1. «Спальня в Арле» — Винсент Ван Гог, 1888—1889 гг.

    Серия из трёх картин нидерландского живописца Ван Гога. Помимо картин, существуют два варианта в эскизах в письмах брату Тео и Гогену. Также одной из отличительных особенностей серии, является то, что художник изображает на полотнах другие свои работы.

    Письмо брату Тео. Октябрь 1888 года: «Наконец-то посылаю небольшой набросок, который даст тебе хоть какое-то представление о ходе работы. Сегодня я снова взялся за нее. Глаза у меня еще побаливают, но у меня уже родился новый замысел, и вот его набросок. Холст опять размером в 30. На этот раз попросту пишу собственную спальню. Вся штука здесь в колорите, упрощая который, я придаю предметам больше стиля, с тем, чтобы они наводили на мысль об отдыхе и сне вообще. Вид картины должен успокаивать мозг, вернее сказать, воображение. Стены — бледно-фиолетовые, пол — из красных плиток. Деревянная кровать и стулья — желтые, как свежее масло; простыня и подушки — лимонно-зеленые, очень светлые. Одеяло — ало-красное. Окно — зеленое. Умывальник — оранжевый, таз — голубой. Двери лиловые. Вот и все, что есть в этой комнате с закрытыми ставнями. Мебель — крупных размеров и всем своим видом выражает незыблемый покой. На стенах портреты, зеркало, полотенце и кое-что из одежды. Рамка — поскольку в картине нет белого — будет белой». [8]

    1. «Благая весть» — Генри Оссава Танеер, 1896г.

    Г. О. Танеер – американский художник — реалист. Первый из художников негритянского происхождения, добившийся международного признания. Картина также изобилует желтым, золотым цветом. Цветом подчеркнут источник света, несущий благую весть.

    1. «Поцелуй» — Густав Климт, 1907—1908 гг.

    Полотно принадлежит к периоду творчества Климта, названному «золотым»: в это время художник много работал с золотым цветом и настоящим листовым сусальным золотом. Популярность картин этого времени, и «Поцелуя» в том числе, связана не в последнюю очередь с применением художником золота в качестве цвета (занимает около семидесяти процентов всего полотна). Золото с незапамятных времён вызывает магические, религиозные ассоциации в равной мере с чувством материальной ценности, значимости. На скале, на краю цветочной поляны, в золотой ауре, стоят полностью погружённые друг в друга, отгороженные от всего мира влюблённые. [8]

    Заключение

    В ходе работы мы попытались открыть для себя символику желтого цвета, расширили своё представление о нем. Проанализировали фрагменты великого романа М. А. Булгакова под названием «Мастер и Маргарита». Познакомились с творениями гениальных художников.

    Необходимо помнить о том, что анализ смысла, который несёт в себе какой-либо цвет, позволяет понять особенность определенной ситуации, при описании которой используется данная деталь, помогает создать общую картину происходящего в том или ином произведении как литературы, так и, тем более, живописи. Исследование цветовых деталей помогает верно определить главную идею произведения.

    «Цвет может успокоить и возбудить, создать гармонию и вызвать потрясение. От него можно ждать чудес, но он может вызвать и катастрофу».

    Жак Вьено (французский художник)

    Список использованной литературы:

    1. Цвет в искусстве. – http://old.iro.yar.ru/resource/distant/music/zvet2.htm

    2. Символизм. – http://www.symbolizm.ru/

    3. Священный Коран. – http://quran-online.ru/

    4. Искусство Юрия Тореева, часть 5 – http://mironovacolor.org/

    5. Мегаэнциклопедия Кирилла и Мефодия. – http://megabook.ru/

    6. Библиотекарь.Ру. – http://www.bibliotekar.ru/index.htm

    7. Живопись Нидерландов XV-XVII вв. – http://www.artniderland.ru/index.php

    8. Википедия. Свободная энциклопедия. – http://ru.wikipedia.org/wiki

    9. Булгаковская энциклопедия. – http://www.bulgakov.ru/

    Приложение

    Фрагмент романа

    Символика жёлтого цвета

    1. Абрикосовая дала обильную желтую пену, и в воздухе запахло парикмахерской. Напившись, литераторы немедленно начали икать, расплатились и уселись на скамейке лицом к пруду и спиной к Бронной.

    выморочность московской жизни, назойливость, дисгармония, душащая пестрота красок

    1. Пилат усмехнулся одною щекой, оскалив желтые зубы, и промолвил, повернувшись всем туловищем к секретарю:

    – О, город Ершалаим! Чего только не услышишь в нем. Сборщик податей, вы слышите, бросил деньги на дорогу!

    болезненность, озлобленность

    1. Тут прокуратор поднялся с кресла, сжал голову руками, и на желтоватом его бритом лице выразился ужас. Но он тотчас же подавил его своею волею и вновь опустился в кресло. <…>

    2. Краска выступила на желтоватых щеках Пилата, и он спросил по-латыни:

    – Как ты узнал, что я хотел позвать собаку?

    – Что еще там? – спросил Пилат и нахмурился.

    1. Прочитав поданное, он еще более изменился в лице. Темная ли кровь прилила к шее и лицу или случилось что-либо другое, но только кожа его утратила желтизну, побурела, а глаза как будто провалились.

    болезненность

    В половине одиннадцатого часа того вечера, когда Берлиоз погиб на Патриарших <…> томились двенадцать литераторов, собравшихся на заседание и ожидавших Михаила Александровича.

    1. <…> Бескудников стукнул пальцем по циферблату, показал его соседу, поэту Двубратскому, сидящему на столе и от тоски болтающему ногами, обутыми в желтые туфли на резиновом ходу.

    ядовитость, напыщенность,

    назойливая пестрота

    1. Ровно в полночь все двенадцать литераторов покинули верхний этаж и спустились в ресторан. Тут опять про себя недобрым словом помянули Михаила Александровича: все столики на веранде, натурально, оказались уже занятыми, и пришлось оставаться ужинать в этих красивых, но душных залах. <…> И ровно в полночь в первом из них что-то грохнуло, зазвенело, посыпалось, запрыгало. И тотчас тоненький мужской голос отчаянно закричал под музыку: «Аллилуйя!» это ударил знаменитый Грибоедовский джаз. <…> и вдруг, как бы сорвавшись с цепи, заплясали оба зала, а за ними заплясала и веранда. Заплясал Глухарев с поэтессой Тамарой Полумесяц, заплясал Квант, заплясал Жуколов-романист с какой-то киноактрисой в желтом платье. Плясали: Драгунский, Чердакчи, маленький Денискин с гигантской Штурман Джоржем, плясала красавица архитектор Семейкина-Галл, крепко схваченная неизвестным в белых рогожных брюках. Плясали свои и приглашенные гости, московские и приезжие, писатель Иоганн из Кронштадта, какой-то Витя Куфтик из Ростова, кажется, режиссер, с лиловым лишаем во всю щеку, плясали виднейшие представители поэтического подраздела МАССОЛИТа, то есть Павианов, Богохульский, Сладкий, Шпичкин и Адельфина Буздяк, плясали неизвестной профессии молодые люди в стрижке боксом, с подбитыми ватой плечами, плясал какой-то очень пожилой с бородой, в которой застряло перышко зеленого лука, плясала с ним пожилая, доедаемая малокровием девушка в оранжевом шелковом измятом платьице.

    вызов, ядовитость, напыщенность, назойливая пестрота

    1. Варенуха проделал все, что полагается человеку в минуты великого изумления. Он и по кабинету пробежался, и дважды вздымал руки, как распятый, и выпил целый стакан желтоватой воды из графина, и восклицал:

    – Не понимаю! Не по-ни-ма-ю!

    ядовитость, духота, несвежесть

    1. В саду ветер дунул в лицо администратору и засыпал ему глаза песком, как бы преграждая путь, как бы предостерегая. Хлопнула во втором этаже рама так, что чуть не вылетели стекла, в вершинах кленов и лип тревожно прошумело, потемнело и посвежело. Администратор протер глаза и увидел, что над Москвой низко ползет желтобрюхая грозовая туча.

    угнетение, тяжесть

    1. Маленький человек в дырявом желтом котелке и с грушевидным малиновым носом, в клетчатых брюках и лакированных ботинках выехал на сцену Варьете на обыкновенном двухколесном велосипеде. Под звуки фокстрота он сделал круг, а затем испустил победный вопль, от чего велосипед поднялся на дыбы. Проехавшись на одном заднем колесе, человек перевернулся вверх ногами, ухитрился на ходу отвинтить переднее колесо и пустить его за кулисы, а затем продолжал путь на одном колесе, вертя педали руками.

    устарелость, ветхость, вызов

    1. И тотчас пол сцены покрылся персидскими коврами, возникли громадные зеркала, с боков освещенные зеленоватыми трубками, а меж зеркал витрины, и в них зрители в веселом ошеломлении увидели разных цветов и фасонов парижские женские платья. Это в одних витринах, а в других появились сотни дамских шляп, и с перышками, и без перышек, и с пряжками, и без них, сотни же туфель – черных, белых, желтых, кожаных, атласных, замшевых, и с ремешками, и с камушками.

    назойливость, вызов, напыщенность, излишняя яркость

    1. – Вы – писатель? – с интересом спросил поэт.

    Гость потемнел лицом и погрозил Ивану кулаком, потом сказал:

    – Я – мастер, – он сделался суров и вынул из кармана халата совершенно засаленную черную шапочку с вышитой на ней желтым шелком буквой «М». Он надел эту шапочку и показался Ивану в профиль и в фас, чтобы доказать, что он – мастер. – Она своими руками сшила ее мне, – таинственно добавил он.

    вызов, яркость, индивидуальность

    1. Она несла в руках отвратительные, тревожные желтые цветы. Черт их знает, как их зовут, но они первые почему-то появляются в Москве. И эти цветы очень отчетливо выделялись на черном ее весеннем пальто. Она несла желтые цветы! Нехороший цвет. Она повернула с Тверской в переулок и тут обернулась. Ну, Тверскую вы знаете? По Тверской шли тысячи людей, но я вам ручаюсь, что увидела она меня одного и поглядела не то что тревожно, а даже как будто болезненно. И меня поразила не столько ее красота, сколько необыкновенное, никем не виданное одиночество в глазах!

    2. Повинуясь этому желтому знаку, я тоже свернул в переулок и пошел по ее следам. Мы шли по кривому, скучному переулку безмолвно, я по одной стороне, а она по другой. И не было, вообразите, в переулке ни души. Я мучился, потому что мне показалось, что с нею необходимо говорить, и тревожился, что я не вымолвлю ни одного слова, а она уйдет, и я никогда ее более не увижу…

    тревога, вызов, запрет

    волнение, душевная теплота, искренность, тревога

    1. И, вообразите, внезапно заговорила она:

    – Нравятся ли вам мои цветы?

    Я отчетливо помню, как прозвучал ее голос, низкий довольно-таки, но со срывами, и, как это ни глупо, показалось, что эхо ударило в переулке и отразилось от желтой грязной стены. Я быстро перешел на ее сторону и, подходя к ней, ответил:

    – Нет.

    грязь, выморочность, болезненность, суетность

    1. Так вот она говорила, что с желтыми цветами в руках она вышла в тот день, чтобы я наконец ее нашел, и что если бы этого не произошло, она отравилась бы, потому что жизнь ее пуста.

    вызов, яркость, тревожность

    1. И, наконец, настал час, когда пришлось покинуть тайный приют и выйти в жизнь.

    – И я вышел в жизнь, держа его в руках, и тогда моя жизнь кончилась, – прошептал мастер и поник головой, и долго качалась печальная черная шапочка с желтой буквой «М». Он повел дальше свой рассказ, но тот стал несколько бессвязен. Можно было понять только одно, что тогда с гостем Ивана случилась какая-то катастрофа.

    тревога, вызов, яркость,

    индивидуальность, противостояние

    1. В печке ревел огонь, в окна хлестал дождь. Тогда случилось последнее. Я вынул из ящика стола тяжелые списки романа и черновые тетради и начал их жечь. <…> Знакомые слова мелькали передо мной, желтизна неудержимо поднималась снизу вверх по страницам, но слова все-таки проступали и на ней. Они пропадали лишь тогда, когда бумага чернела и я кочергой яростно добивал их.

    ветхость, пламя, тревога, яд

    1. Варенуха, не снимая кепки, прошел к креслу и сел по другую сторону стола. <…> – Какая там, к черту, Ялта! Напоил пушкинского телеграфиста, и начали оба безобразничать, в том числе посылать телеграммы с пометкой «Ялта».

    – Ага… Ага… Ну ладно, ладно… – не проговорил, а как бы пропел Римский. Глаза его засветились желтеньким светом.

    мистичность, приближающаяся опасность, страх, тревожность

    1. Дунчиль спокойно и с достоинством повернулся и пошел к кулисе.

    – Одну минуточку! – остановил его конферансье, – позвольте мне на прощанье показать вам еще один номер из нашей программы <…>

    Черный задний занавес раздвинулся, и на сцену вышла юная красавица в бальном платье, держащая в руках золотой подносик, на котором лежала толстая пачка, перевязанная конфетной лентой, и бриллиантовое колье, от которого во все стороны отскакивали синие, желтые и красные огни.

    Дунчиль отступил на шаг, и лицо его покрылось бледностью. Зал замер.

    – Восемнадцать тысяч долларов и колье в сорок тысяч золотом, – торжественно объявил артист, – хранил Сергей Герардович в городе Харькове в квартире своей любовницы Иды Геркулановны Ворс, которую мы имеем удовольствие видеть перед собою и которая любезно помогла обнаружить эти бесценные, но бесцельные в руках частного лица сокровища.

    – А под вашею полною достоинства личиною, – отнесся артист к Дунчилю, – скрывается жадный паук и поразительный охмуряло и врун. Вы извели всех за полтора месяца своим тупым упрямством. Ступайте же теперь домой, и пусть тот ад, который устроит вам ваша супруга, будет вам наказанием.

    власть денег, циничность, вызов, дороговизна, запретность

    1. Теперь, сидя на камне, этот чернобородый, с гноящимися от солнца и бессонницы глазами человек тосковал. Он то вздыхал, открывая свой истасканный в скитаниях, из голубого превратившийся в грязно-серый таллиф, и обнажал ушибленную копьем грудь, по которой стекал грязный пот, то в невыносимой муке поднимал глаза в небо, следя за тремя стервятниками, давно уже плававшими в вышине большими кругами в предчувствии скорого пира, то вперял безнадежный взор в желтую землю и видел на ней полуразрушенный собачий череп и бегающих вокруг него ящериц.

    Мучения человека были настолько велики, что по временам он заговаривал сам с собой.

    болезненность, тревога, грусть, смерть, безнадёжность

    1. Левий увидел, что все в мире, под влиянием ли его проклятий или в силу каких-либо других причин, изменилось. Солнце исчезло, не дойдя до моря, в котором тонуло ежевечерне. Поглотив его, по небу с запада поднималась грозно и неуклонно грозовая туча. Края ее уже вскипали белой пеной, черное дымное брюхо отсвечивало желтым.

    угнетенность, безвыходность, неизбежность, тревожность, опасность

    1. Счастливее двух других был Иешуа. В первый же час его стали поражать обмороки, а затем он впал в забытье, повесив голову в размотавшейся чалме. Мухи и слепни поэтому совершенно облепили его, так что лицо его исчезло под черной шевелящейся массой. В паху, и на животе, и под мышками сидели жирные слепни и сосали желтое обнаженное тело.

    болезненность, приближение

    опасности,

    1. Пришлось называть вещи своими именами и признаться в том, что администрация Варьете, в лице директора, финдиректора и администратора, пропала и находится неизвестно где <…> через короткое время в здании Варьете появилось следствие в сопровождении остроухой, мускулистой, цвета папиросного пепла собаки с чрезвычайно умными глазами. Среди служащих Варьете тотчас разнеслось шушуканье о том, что пес – не кто другой, как знаменитый Тузбубен. И точно, это был он. Поведение его изумило всех. Лишь только Тузбубен вбежал в кабинет финдиректора, он зарычал, оскалив чудовищные желтоватые клыки, затем лег на брюхо и с каким-то выражением тоски и в то же время ярости в глазах пополз к разбитому окну.

    опасность, ярость

    1. – Азазелло!

    На его зов в переднюю выбежал маленький, прихрамывающий, обтянутый черным трико, с ножом, засунутым за кожаный пояс, рыжий, с желтым клыком, с бельмом на левом глазу.

    опасность, ярость

    1. Вы когда умрете?

    Тут уж буфетчик возмутился.

    – Это никому не известно и никого не касается, – ответил он.

    – Ну да, неизвестно, – послышался все тот же дрянной голос из кабинета, – подумаешь, бином Ньютона! Умрет он через девять месяцев, в феврале будущего года, от рака печени в клинике Первого МГУ, в четвертой палате.

    Буфетчик стал желт лицом.

    болезненность, страх, приближение опасности, безвыходность

    1. Сердце Маргариты страшно стукнуло, так что она не смогла даже сразу взяться за коробочку. Справившись с собою, Маргарита открыла ее и увидела в коробочке жирный желтоватый крем.

    мистичность, вызов

    1. Ощипанные по краям в ниточку пинцетом брови сгустились и черными ровными дугами легли над зазеленевшими глазами. Тонкая вертикальная морщинка, перерезавшая переносицу, появившаяся тогда, в октябре, когда пропал мастер, бесследно пропала. Исчезли и желтенькие тени у висков, и две чуть заметные сеточки у наружных углов глаз.

    болезненность, печаль, старость

    1. – Бал! – пронзительно визгнул кот, и тотчас Маргарита вскрикнула и на несколько секунд закрыла глаза. Но лес быстро кончился, и его банная духота тотчас сменилась прохладою бального зала с колоннами из какого-то желтоватого искрящегося камня.

    мистичность, дороговизна,

    1. Голова Маргариты начала кружиться от запаха вина, и она уже хотела уходить, как кот устроил в бассейне номер, задержавший Маргариту. Бегемот наколдовал чего-то у пасти Нептуна, и тотчас с шипением и грохотом волнующаяся масса шампанского ушла из бассейна, а Нептун стал извергать не играющую, не пенящуюся волну темно-желтого цвета.

    тревожность

    1. Вы уходите в небытие, а мне радостно будет из чаши, в которую вы превращаетесь, выпить за бытие. – Воланд поднял шпагу. Тут же покровы головы потемнели и съежились, потом отвалились кусками, глаза исчезли, и вскоре Маргарита увидела на блюде желтоватый, с изумрудными глазами и жемчужными зубами, на золотой ноге, череп.

    смерть, опасность, тревога,

    мистичность, вызов

    1. В дремоте перед Иваном являлся неподвижный в кресле человек, бритый, с издерганным желтым лицом, человек в белой мантии с красной подбивкой, ненавистно глядящий в пышный и чужой сад. Видел Иван и безлесый желтый холм с опустевшими столбами с перекладинами.

    А происшедшее на Патриарших прудах поэта Ивана Бездомного более не интересовало.

    тревожность, болезненность;

    пустынность, одиночество, печаль

    Продавцы за рыбным прилавком как окаменели со своими ножами в руках, сиреневый иностранец повернулся к грабителям, и тут же обнаружилось, что Бегемот не прав: у сиреневого не не хватало чего-то в лице, а, наоборот, скорее было лишнее – висящие щеки и бегающие глаза.

    1. Совершенно пожелтев, продавщица тоскливо прокричала на весь магазин:

    – Палосич! Палосич!

    недоумение, тревога, выморочность, болезненность, страх

    1. Он (Арчибальд Арчибальдович) лично отодвинул стул от столика, приглашая Коровьева сесть, мигнул одному, что-то шепнул другому, и два официанта засуетились возле новых гостей, из которых один свой примус поставил рядом со своим порыжевшим ботинком на пол. Немедленно исчезла со стола старая скатерть в желтых пятнах, в воздухе, хрустя крахмалом, взметнулась белейшая, как бедуинский бурнус, другая, а Арчибальд Арчибальдович уже шептал тихо, но очень выразительно, склоняясь к самому уху Коровьева:

    – Чем буду потчевать?

    обветшалость;

    грязь, выморочность


    Первое подтвержденное появление вируса желтой лихорадки и переносчика вируса денге Aedes (Stegomyia) luteocephalus (Newstead, 1907 г.) в Мозамбике | Паразиты и переносчики

    Всего из собранных личинок и куколок появилось 92 взрослых комара; из них 16 были предварительно идентифицированы как Ae. luteocephalus (12 самок и 4 самца) по морфологическим признакам. Остальные экземпляры были идентифицированы как Anopheles ( Celia ) garnhami ( n = 1), Ae. ( Aedimorphus ) vittatus ( n = 24), Ae. ( Stg.) aegypti ( n = 4), Culex ( culiciomyia ) nebulosus ( n = 28), Eretmapodites 18 subimplicipes (9000 3 000 subimplicipes) Toxorhynchites brevipalpis ( n = 1) (табл.1).

    Таблица 1 Дата сбора, виды комаров, пол, их соответствующие ниши, процент (%) и количество москитов, собранных в Мозамбике

    Десять самок Ae.luteocephalus , собранные в ходе этого исследования, были депонированы в хранилище насекомых Instituto Nacional de Saúde (INS) в провинции Мапуту, Мозамбик, и хранились в отдельных пробирках Eppendorf ® (инвентарные номера MZ113-a1.2, a1.4 – a1.12). ) и 6 образцов (2 самки и 4 самца) депонированы в Entomoteca (коллекция насекомых) Института гигиены и тропической медицины (IHMT), Лиссабон, Португалия (инвентарные номера MZ113-a1.1 – a1.3 и MZ113-a2. .1 – a2.4).

    Все 16 личинок, давших имаго Ae.luteocephalus и 5 Ae. vittatus были обнаружены вместе в скалистом бассейне с чистой водой размером примерно 20 × 15 см (дополнительный файл 1: Рисунок S1), расположенном на берегу реки Луауи и подвергающемся воздействию солнечного света. Остальные виды, включая оставшиеся 19 Ae. vittatus были получены из других мест размножения, а именно с покрышек, которые были помещены в качестве «овитрапсов», в то время как экземпляров Ae. luteocephalus были получены из любого другого места размножения (Таблица 1). Для сбора дополнительной информации о Ae необходимы исчерпывающие исследования.luteocephalus , чтобы лучше понять важность этого и других арбовирусных переносчиков по всей стране.

    Место обитания, где они были обнаружены, соответствует естественному диапазону местообитаний тропических лесов. Действительно, Ae. luteocephalus можно встретить в лесах, саваннах, мангровых галерейных лесах, а также в ландшафтах, промежуточных между лесными и городскими районами [15, 17, 20]. Биономически этот вид использует различные места размножения, такие как гнили, дупла деревьев, ямы в камнях, бамбук, стебли бамбука, вилки для деревьев, пластиковые бутылки и искусственные контейнеры высотой до 9 метров [15,16,17,18,19,20 ]. Aedes luteocephalus места размножения с аналогичными характеристиками также были зарегистрированы в других местах и ​​связаны с Ae. africanus из той же группы, но, насколько нам известно, с Ae. vittatus , что неудивительно, поскольку этот более поздний вид также предпочитает каменные бассейны [15,16,17,18,19,20].

    Предварительный анализ нуклеотидных последовательностей мтДНК cox 1, полученных от 4 самцов, выявил полностью идентичные последовательности, что позволяет предположить, что Ae . luteocephalus личинок были потомками [28], возможно, вылупившимися из яиц, отложенных одной самкой, поскольку мтДНК наследуется по материнской линии, что вполне возможно с учетом небольших размеров резервуара размножающихся пород (дополнительный файл 1: Рисунок S1).

    Лабораторные эксперименты показали, что Ae. luteocephalus может передавать желтую лихорадку с эффективностью, сравнимой с Ae. aegypti [23], легко кусает людей и участвует в передаче YFV в Западной и Центральной Африке, а вирус чикунгунья (CHIKV), ZIKV и DENV2 были изолированы от него в Западной Африке [15].Хотя Ae. luteocephalus была преимущественно сельской и лесной средой, что увеличивало демографическое расширение и человеческое давление на лесные ресурсы, для лесозаготовок и земледелия, как это наблюдалось в исследуемом месте. Это состояние может также увеличить вероятность заражения человека переносчиком и, следовательно, риск эпидемий арбовируса в сельской местности. Поэтому срочно необходимы дополнительные исследования для изучения влияния антропогенной деятельности на риск передачи арбовирусов в районе Лаго.

    Все Ae. luteocephalus особей, собранных в этом исследовании, имели отчетливую среднюю продольную желтую полосу из тонких чешуек в области скутума; щитик с широкими белыми чешуйками на боковых лопастях; базальная светлая полоса на II-VI тергах более желтая; и заднее бедро спереди с огромной светлой полосой в основании и рядом с двумя значительными белыми пятнами на срединной и апикальной областях (рис. 1). Эти характеристики аналогичны характеристикам, описанным Хуангом [15] и Джаппом [21].

    Рис. 1

    a Взрослая самка экземпляра Aedes luteocephalus с общими признаками. b Взрослый образец, выделяющий основные диагностические признаки, включая щиток (с продольной желтой полосой) и задний тарсомер спереди с большой светлой полосой у основания и двумя большими белыми пятнами на срединной и апикальной областях (wp), оба изображения при увеличении 20 ×

    На всех четырех рассеченных гениталиях самцов были обнаружены гонококситы с простым гоностилем с несколькими щетинками в апикальной четверти и длинным тонким гоностилярным когтем, большая застежка с лопастями, с расширенной дистальной частью, овальная на виде сверху, с многочисленными простыми щетинками. на апиколатеральной части и с короткими щетинками на апикомезальной части (рис.2). Они считаются наиболее важными отличительными признаками, отделяющими вид от других представителей группы africanus , а именно Aedes ( Stg. ) africanus , к которой он принадлежит [15, 21].

    Рис.2

    Расщепленные гениталии самцов Aedes luteocephalus с гонококситами с гоностилем ( a ) с гоностилярным когтем и класпетом ( b ), большие, лопастные с дистальной расширенной частью, овальные на виде сверху, с многочисленными простыми щетинки на апиколатеральной части и несколько коротких щетинок на апикомезальной части и эдеагусе ( c ) при увеличении 100 ×. Шкала : 100 мкм

    Последовательности гена штрих-кода всех проанализированных образцов показали 97,65–98,12% идентичности последовательностей с гомологами при использовании BLAST (опция MegaBlast) и 97,82–98,26% идентичности в базе данных BOLDSYSTEMS с последовательностями Ae . luteocephalus из Танзании и Кении, что подтверждает его таксономическую принадлежность [19, 20, 22]. Насколько нам известно, эти находки представляют собой первую подтвержденную запись о Ae. luteocephalus в Мозамбике, тогда как все другие образцы, собранные в этом исследовании, соответствуют таксонам, уже известным для страны.Кроме того, анализ филогенетической реконструкции, проведенный на основе набора данных из нескольких видов Aedes подрода Stegomyia , Aedimorphus , Neomelaniconion и Ochlerotatus , четко поместил последовательностей cox . этого исследования в топологически стабильном монофилетическом кластере, который включал только Ae. luteocephalus референсных последовательностей (рис. 3). Это дополнительно подтверждает морфологическую идентификацию, идентификацию на основе штрих-кода и сходства последовательностей, представленную выше.Таким образом, наши результаты однозначно подтверждают, что Ae. luteocephalus , собранные в исследуемой области, очень похожи на таковые из соседних стран Танзании и Кении [19, 20, 22] и теперь были обнаружены в рамках широкого исследования в стране на предмет переносчиков арбовирусов Abílio et al., неопубликовано данные). Рекомендуется дальнейший анализ сети гаплотипов для обеспечения надежного вывода о точном происхождении Ae. luteocephalus из Мозамбика.

    Рис. 3

    Филогенетическое дерево максимального правдоподобия на основе частичных последовательностей Aedes cox 1.Показаны значения узловой опоры ≥ 75. Используемые эталонные последовательности указываются либо их регистрационным номером GenBank, либо кодом BoldSystems. Последовательности, полученные в этом исследовании, выделены жирным шрифтом в соответствии с их лабораторным кодом и номерами доступа и сгруппированы в монофилетический кластер, обозначенный как Moz-кластер. Масштабная линейка показывает количество замен нуклеотидов на сайт

    Образование, общественное здравоохранение, интегрированная борьба с комарами

    Желтая лихорадка — острое вирусное заболевание.Вирус желтой лихорадки — это флавивирус с 400-летней историей. Заболевание возникло в Африке, а затем распространилось в Южную Америку в 1600-х годах. Первые сообщения о желтой лихорадке в США были зарегистрированы в 1699 году в Чарльстоне, Южная Каролина, и Филадельфии, штат Пенсильвания. Сегодня желтая лихорадка встречается в Южной Америке и Африке и вызывает около 200 000 инфекций и 30 000 смертей ежегодно. К счастью, есть эффективная вакцина против желтой лихорадки.

    Желтая лихорадка распространяется через три цикла передачи; городской, лесной и средний.Болезнь в основном передается человеку через укус инфицированного комара, Aedes aegypti , и эти комары заражаются вирусом, питаясь другими инфицированными людьми. Это известно как городской цикл. Лесной цикл, или цикл джунглей, включает передачу вируса через приматов, не являющихся людьми, в дикой природе. Люди могут заразиться этими комарами при посещении или работе в джунглях. Переносчики, вовлеченные в цикл джунглей, включают Aedes africanus в Африке или комаров из рода Haemagogus и Sabethes в Южной Америке.Существует промежуточный цикл, в котором полудомашние комары вида Aedes служат переносчиками, а приматы — как люди, так и приматы — служат резервуарами для болезни.

    Симптомы желтой лихорадки
    • У большинства инфицированных не наблюдается никаких симптомов.
    • У тех, кто действительно заболел, симптомы включают жар, озноб, головную боль, тошноту и потерю аппетита. Другие симптомы могут включать боли в мышцах, особенно в спине.
    • Большинство пациентов выздоравливают примерно через 4 дня, хотя примерно у 15% наблюдается вторая, более серьезная фаза болезни.
    • Вторая фаза желтой лихорадки связана с высокой температурой и повреждением печени, вызывающим пожелтение кожи. Также может произойти отказ нескольких органов. Смертность среди тяжелых случаев заболевания оценивается от 20 до 50%.
    Лечение инфекции желтой лихорадки
    • От желтой лихорадки нет лекарства.
    • Лечение симптоматическое и заключается в том, чтобы помочь пациенту почувствовать себя комфортнее.

    Вакцина против желтой лихорадки

    Существует вакцина от этой болезни, и она настоятельно рекомендуется или требуется для тех, кто путешествует в районы высокого риска в Южной Америке и Африке.

    CDC ведет список стран, в которых вакцинация против желтой лихорадки требуется или рекомендуется для путешественников. Вакцина рекомендуется для детей в возрасте 9 месяцев и старше.Реакции на вакцину обычно редкие и легкие, хотя есть риск более серьезных реакций. Путешественникам следует проконсультироваться со своим врачом, чтобы обсудить вакцинацию, если они планируют отправиться в районы, подверженные риску заболевания.

    Желтая лихорадка и США

    Желтая лихорадка была завезена в США в конце 1600-х годов, при этом основные эпидемии произошли с 1793 по 1905 год. Сегодня эндемичные районы ограничены Африкой и Южной Америкой. Однако комары Aedes aegypti встречаются в южных прибрежных штатах, и существует риск заражения людей во время путешествия и последующего возвращения в США.С. существует.

    Желтая лихорадка со всего мира

    В странах Африки к югу от Сахары желтая лихорадка встречается регулярно, и на нее приходится подавляющее большинство всех случаев заболевания и смерти людей, связанных с желтой лихорадкой. Однако бывают также периодические, более непредсказуемые вспышки городской желтой лихорадки по всему континенту. По крайней мере, 32 африканские страны в настоящее время считаются подверженными риску желтой лихорадки с общим населением в 610 миллионов человек.

    Желтая лихорадка также эндемична в 10 странах Южной и Центральной Америки и на нескольких островах Карибского моря.Боливия, Бразилия, Колумбия, Эквадор, Перу и Венесуэла считаются подверженными наибольшему риску. Хотя болезнь обычно вызывает только спорадические случаи и небольшие вспышки, почти все крупные городские центры в американских тропиках были повторно заражены Aedes aegypti . Из-за утраты организованных программ борьбы с комарами и последующего повторного заражения первичным переносчиком инфекции в Латинской Америке сейчас существует больший риск городских эпидемий, чем когда-либо за последние 50 лет.

    Карта взята с веб-сайта CDC.Текущая по состоянию на июль 2015 г. Эта карта, которая соответствует рекомендациям, также опубликованным Всемирной организацией здравоохранения (ВОЗ), представляет собой обновленную версию карты 2010 г., созданной Неофициальной рабочей группой ВОЗ по географическому риску желтой лихорадки.

    Знай своего

    Aedes Mosquiotes

    Aedes aegypti , комар желтой лихорадки, характеризуется серебристо-белыми чешуйками в форме лиры на груди. Это перидоместический вид, обитающий недалеко от жилищ человека.В основном они кормятся рано утром или поздно вечером, но самки также могут принимать кровяную муку ночью при искусственном освещении. Обычно Ae.aegypti летают всего в нескольких сотнях ярдов от места своего размножения.

    Этот вид использует контейнеры для размножения, и информирование общественности о том, как уничтожить среду обитания личинок на заднем дворе, является одним из ключей к удержанию этих захватчиков под контролем. Личинок можно найти в различных искусственных контейнерах, включая ведра, шины, банки и цветочные горшки.Домовладельцы также должны проверять водосточные желоба на предмет засоров, садового инвентаря и детских игрушек на заднем дворе.

    Борьба с

    Aedes aegypti и желтой лихорадкой

    Программа комплексной борьбы с комарами (IMM) необходима для предотвращения укусов комаров и передачи серьезных переносчиков болезней в Соединенных Штатах. В рамках эффективной программы IMM VDCI рекомендует четырехэтапный подход, охватывающий все фазы жизненного цикла комара.

    1: Государственное образование
    Специалисты по борьбе с комарами могут сделать не так много, и именно поэтому мы полагаемся на хорошо образованную публику, чтобы иметь успешную программу борьбы с комарами.Просвещение общественности дает людям возможность контролировать размножение комаров на заднем дворе и дает им инструменты, необходимые для уменьшения раздражения комаров.

    2: Наблюдение
    Наблюдение позволяет нам обнаруживать виды комаров в заданном районе, а также любые изменения в популяциях. Обладая этими ценными данными, мы можем более эффективно рассчитывать время применения ларвицидов и более точно определять действия по уничтожению взрослых особей.

    3: Борьба с личинками от комаров
    Наши обученные полевые техники проверяют как известные источники стоячей воды, так и любые недавно обнаруженные места на предмет присутствия личинок комаров.Уничтожение комаров до того, как они станут взрослыми, является важным элементом борьбы с болезнями, передаваемыми комарами, поскольку это останавливает комаров до того, как они заразятся вирусом и получат возможность передать его людям.

    4: Борьба с комарами среди взрослых
    При необходимости для обработки взрослыхицидов используются пестициды, одобренные Агентством по охране окружающей среды, которые используются наиболее безопасным и экологически безопасным способом. Кроме того, VDCI регулярно проверяет взрослых комаров и принимает все необходимые меры для предотвращения развития у них резистентности; тем самым сводя к минимуму количество приложений, необходимых для управления популяцией.

    VDCI — это компания, построенная на принципах общественного здравоохранения, этики, профессионализма и технических знаний. Мы разрабатываем программы борьбы с переносчиками болезней, которые основаны на понимании экологии основного переносчика и опираются на современную науку об экологически безопасных мерах контроля.

    Назад к трансмиссивным болезням

    Борьба с комарами и переносчиками болезней | Город Менло-Парк

    Aedes aegypti, также называемый комаром желтой лихорадки, был зарегистрирован в районах Менло-Парка.Хотя этот комар не является обычным или широко распространенным явлением, он может стать серьезной угрозой для здоровья человека, если ему разрешат обосноваться в округе Сан-Матео.

    Этот вид комаров не является аборигенным для нашего округа и может передавать такие болезни, как Зика, чикунгунья, желтая лихорадка и денге. В настоящее время эти болезни отсутствуют в округе Сан-Матео, но для снижения будущих рисков для здоровья важно предотвратить рост популяций инвазивных комаров.

    Вы можете помочь защитить наше сообщество от инвазивных комаров Aedes, следуя нескольким простым рекомендациям:

    • Проверьте свою собственность на наличие стоячей воды и емкостей, в которых может скапливаться вода после дождя.Инвазивные комары Aedes предпочитают искусственные контейнеры (цветочные горшки, ведра, бутылки, банки и т. Д.) И могут развиваться в контейнерах размером с колпачок от бутылки из-под газировки. Любая емкость может стать рассадником комаров.
    • Удалите или переверните все емкости, в которых собирается вода. Контейнеры, которые нельзя вынуть, необходимо еженедельно опорожнять и чистить, чтобы удалить яйца комаров. Инвазивные яйца Aedes могут пережить высыхание, поэтому недостаточно опорожнять контейнеры — их также необходимо вымыть.
    • Избегайте приносить растения, горшки или другие предметы на открытом воздухе из районов, где обитают инвазивные Aedes (включая центральную и южную Калифорнию, Аризону, Техас и Флориду). Если вы приносите предметы из этих мест, опорожните все контейнеры и потрите их, чтобы удалить яйца комаров.
    • Если вы заметили укусы комаров в течение дня, свяжитесь с округом, чтобы мы могли проверить ваш район на наличие инвазивных комаров Aedes. В отличие от большинства местных видов комаров, инвазивные комары Aedes кусаются в течение дня.
    Жители, которые считают, что они столкнулись с комарами Aedes aegypti, или которые укусы комаров в течение дня, должны связаться с округом Сан-Матео по борьбе с комарами и переносчиками болезней.

    Район по борьбе с комарами и переносчиками инфекции округа Сан-Матео также доступен для оказания помощи жителям в удалении большого количества нежелательных контейнеров с их территории, выявлении мест, где могут размножаться комары, обнаружении источника любой существующей проблемы с комарами и обработке стоячей воды от личинок комаров.

    Округ Сан-Матео по борьбе с комарами и переносчиками болезней использует комплексную стратегию борьбы с вредителями для защиты здоровья и комфорта жителей округа Сан-Матео. Зона обслуживания округа включает всю округу Сан-Матео.

    Трансмиссивные болезни сформировали историю человечества и выявляют расовые различия

    UNIVERSITY PARK, PA. Трансмиссивные болезни (VBD), такие как чума, малярия и желтая лихорадка, существенно повлияли на общество и культуру, согласно международным команда исследователей.В исследовании, опубликованном в журнале Ecology Letters 27 января, команда использовала исторические свидетельства, интерпретированные через экологическую призму, чтобы проиллюстрировать, как VBD повлияли на историю человечества, с особым вниманием к тому, как VBD усилили и обострили расизм.

    «Непропорционально сильное воздействие пандемии COVID-19 на цветные сообщества в Америке открыло многим людям глаза на несправедливость в отношении здоровья и важность структурного расизма в последствиях для здоровья и уязвимости», — сказала автор Нита Бхарти, доцент кафедры биологии, Пенн. Состояние.«Важно отметить, что связь между расой и неравенством в отношении здоровья не нова. В этой статье мы показали, что социально сконструированный системный расизм и вытекающая из него иерархия власти создают и поддерживают неравенство в отношении здоровья. Этот образец неоднократно возникал на протяжении истории и сохраняется до наших дней. Мы выделили эти ссылки для трансмиссивных болезней ».

    По словам команды, VBD повлияли на историю человечества через множество социально-экологических механизмов, в том числе:

    • Убийство или истощение большого числа людей с демографическими последствиями и последствиями на уровне населения.
    • Дифференциальное воздействие на популяции на основе предшествующего анамнеза заболевания, иммунитета и устойчивости.
    • Используется как оружие для поощрения или оправдания иерархии власти, колониализма, расизма, классизма и сексизма.
    • Катализатор изменений в идеях, учреждениях, инфраструктуре, технологиях и социальной практике в усилиях по борьбе со вспышками болезней.
    • Изменение отношения человека к земле и окружающей среде.

    В своей статье команда исследовала эти механизмы и представила тематические исследования четырех основных болезней — чумы, малярии, желтой лихорадки и трипаносомоза, — которые на протяжении всей истории оказывали глубокое влияние на людей.

    Благодаря своей работе исследователи открыли повторяющиеся темы в разных обществах во времени. Одна тема заключалась в том, что болезни не влияют на все группы населения одинаково — простой факт, который имел серьезные разветвления на протяжении всей истории. Например, во время американской революции многие американцы выросли на Юге и в молодом возрасте заразились малярией, что позволило им развить иммунитет. Это дало им стратегическое преимущество перед менее защищенной британской армией, которая была уничтожена болезнью.

    Более отрезвляющая тенденция, выявленная в ходе исследований группы, заключалась в том, что болезни, как правило, подпитываются неравенством в обществе, оставляя маргинализированные группы наиболее подверженным риску. Как намеренно, так и непреднамеренно, его снова и снова использовали в качестве оружия для насаждения несправедливой иерархии власти, сообщают исследователи. На юге Америки, например, порабощенных чернокожих людей часто заставляли работать в условиях, которые подвергали их воздействию комаров и делали их гораздо более уязвимыми для малярии. Что еще хуже, это неравенство использовалось белыми людьми для поощрения расистской веры в то время, что чернокожие американцы морально неполноценны, и для оправдания законов о сегрегации Джима Кроу на Юге.

    «Существуют значительные пробелы в преподавании и изучении экологии болезней, потому что она часто отделена от аспектов социальных наук, которые являются решающими движущими факторами в эпидемиологии», — сказала Бхарти, отметив, что ее роль в проекте заключалась в том, чтобы донести тему расовое неравенство в отношении власти и здоровья к обсуждению экологии болезней и трансмиссивных болезней. «К сожалению, для ученых нет ничего необычного в том, что они обладают лишь минимальными знаниями в разных областях и дисциплинах. Но важно расширить наше понимание результатов в отношении здоровья, чтобы выделить, когда они в значительной степени обусловлены взаимосвязанными социальными факторами.Это помогает нам определить все первопричины заболеваний, что важно для их непосредственного устранения ».

    Структурный расизм, включая то, в каких районах могут жить люди и их доступ к богатству разных поколений, связан с неравенством в уровнях диабета, гипертонии и других хронических заболеваний, связанных со стрессом, добавила Эрин Мордехай, доцент биологии Стэнфордского университета. Эти различия также очевидны в пандемии COVID-19, где последствия заболевания более серьезны для людей, страдающих этими состояниями.Это непропорциональное бремя еще больше усиливает уязвимость и без того находящихся в неблагоприятном положении сообществ.

    «Когда вы накладываете на развивающуюся пандемию существующие диспропорции в отношении здоровья, она непропорционально затрагивает общины чернокожих и латиноамериканцев», — сказал Мордехай.

    Расовые различия также подвергают исторически маргинализированные сообщества большему риску заражения вирусом. Например, вспышки лейшманиоза, трансмиссивного заболевания, распространяемого флеботомными москитами, затронули сотни тысяч сирийцев в лагерях беженцев в результате перенаселенности районов с плохой санитарией.И когда в 2014 году в Африке возникли первые несколько случаев вспышки Эболы, ученые в Соединенных Штатах не спешили находить способы борьбы с ней, пока она не обнаружилась ближе к дому.

    Авторы заявили, что они надеются, что эта статья побудит ученых более активно защищать людей в исторически неблагополучных сообществах от болезней.

    «Двигаясь вперед, совершенно необходимо, чтобы исследования открыто признавали и боролись со структурным расизмом, классизмом и сексизмом, которые продолжают увековечивать несправедливость в отношении окружающей среды и здоровья», — сказал Теджас Атни, студент Стэнфордского университета и первый автор статьи.«Справедливость должна быть поставлена ​​в центр экологии и глобального здоровья, чтобы добиться значимого прогресса для всего человечества».

    Дополнительные соавторы Стэнфордского университета: Джулио А. Де Лео, профессор биологии и старший научный сотрудник Института окружающей среды Вудса; Кэтрин Оливариус, доцент кафедры истории; докторант Девин Кирк; бывшие постдокторанты Марта Шокет и Джейми Колдуэлл; аспиранты Лиза И. Купер, Николь Нова, Марисса Чайлдс и Дэвид Г.Пикель; и студенты и бывшие студенты Джулиан Ченг, Элизабет А. Грант, Патрик М. Курцнер, Со Чжо, Брэдфорд Дж. Лин, Рикардо К. Лопес, Диба С. Массихпур, Эрика К. Олсен, Мэгги Роуч, Энджи Руис, Эмили А. Шульц, Маскан Шафат и Ребекка Спенсер. Шокет также связан с Калифорнийским университетом в Лос-Анджелесе, Колдуэлл также связан с Гавайским университетом в Маноа, а Кирк также связан с Университетом Британской Колумбии. В статье также приняли участие исследователи из Университета Джеймса Кука, Калифорнийского университета в Санта-Барбаре и Калифорнийского университета в Дэвисе.

    Это исследование было поддержано Стэнфордской программой вводных семинаров, Национальным научным фондом, Национальными институтами здравоохранения, стипендией Хелмана, стипендией Термана, Центром глобального развития Кинга, Институтом наук о жизни Хака при Университете штата Пенсильвания, Стэнфордским университетом. Междисциплинарная программа стипендий для аспирантов, Стэнфордские ученые по науке о данных, Стэнфордский Вудский институт окружающей среды, Стэнфордский институт инноваций в развивающихся странах, Инициатива глобального развития и бедности, Стэнфордская стипендия для аспирантов и Стипендия Рика Вейланда в области гуманитарных и естественных наук .

    ✅ желтый бесплатный вектор eps, cdr, ai, svg векторная иллюстрация графика

    Желтый фон. Векторная иллюстрация.

    Яркое векторное солнце с бликами

    Желтый фон

    Фон с абстрактными плавными линиями

    Желтый абстрактный узор

    Абстрактный желтый фон.Векторная иллюстрация

    Желтый абстрактный узор с треугольниками и квадратами

    Абстрактный точечно-желтый фон

    Солнечный свет

    Векторный дизайн абстрактного фона.

    Абстрактный желтый фон

    Желтая джинсовая текстура для фона

    Абстрактный вектор Санберст.

    Желтый фон

    Оранжевый дым на желтом фоне.

    Абстрактный желтый квадратный фон

    Желтая лента.

    Вектор солнце на желтом фоне

    Набор бесшовных узоров

    Абстрактные векторные оранжевый и желтый фон

    Творческий случайный треугольный узор на желтом фоне

    Светло-желтый многоугольник абстрактный фон

    Абстрактный желтый фон

    Гранж капли ярко-желтый фон

    Приглашение на детский душ унисекс

    Абстрактный фон

    Фон желтый

    Бесшовные векторные шаблон с маленькими белыми точками в горошек на солнечно-желтом фоне.

    Фон взрывающихся звезд

    Композиция черно-желтого фона

    Бесшовный фон. Векторная иллюстрация

    10 различных желтых и серых узоров

    Желтый фон боке

    Абстрактный желтый фон

    Абстрактный точечно-желтый фон

    Желтая лента осведомленности на белом фоне.

    Абстрактная бумажная стрелка инфографики элементы шаблона

    Желтый абстрактный фон

    Темный контрастный черный желтый фон

    Векторный дизайн абстрактного фона волнистые.

    Абстрактный желтый фон

    Желтый фон с цветочным орнаментом

    Яркий векторный фон с эффектом солнца

    Очередь полиции и ленты с опасностями на темном фоне

    Яркий фон с веслами

    Фон желтый

    Желтый летний фон

    Шаблоны дизайна

    Роскошные бесшовные золотые цветочные обои

    Милые акварельные цветы

    Векторные цветы нарциссов.Желтые туши с гравировкой. Бесшовные модели. Текстура печати обоев ткани на белой предпосылке.

    Squama рыбы змея ящерица весы бесшовного фона.

    Набор креативных визиток

    Красивый фон солнечных лучей

    Вектор яркий фон желтого цвета

    Роскошный сине-желтый дизайн

    Оранжевые волны

    Абстрактный дизайн вектор красочные круги

    Вихрь абстрактных форм и светлый фон.

    Чертеж высокотехнологичный

    Современная визитка — желтый и черный цвета

    Абстрактный вихревой яркий фон оранжевого цвета

    Желтая линованная бумага

    Абстрактный гранж желтый и белый фон

    Весенний бесшовный узор

    Абстрактный фон мозаики.

    Новогодняя аппликация фон

    Абстрактный солнечный фон

    Пустые желтые ценники Векторный icon

    Осенний фон

    Абстрактный оранжевый фон

    Черно-желтый

    Роскошная обложка для книги, уголь и золото

    Желтый акварельный фон

    Набор баннеров

    Яркое жаркое летнее солнце с бликами

    Абстрактный желтый фон

    Бант из желтой ленты горизонтальный бордюр

    Желтый пост для заметок

    Желтый фон

    Абстрактный золотой фон с сверкающими звездами.Вектор

    Цвет фона в пересекающихся полосах

    Абстрактный фон оранжевая волна

    Векторный оранжевый фон

    Желтый цвет фона

    Векторный дизайн абстрактного фона волнистые.

    Красивый цветок ромашки.

    Грустный смайлик мультяшный смайлик

    Абстрактный фон треугольника, векторные иллюстрации

    Абстрактная пунктирная фоновая текстура

    Бесшовные шаблоны — цифровой альбом

    Летнее время фон с текстом — иллюстрация

    Векторная иллюстрация

    Ярко-желтый векторный мазок кисти ручной росписью фон с брызгами краски

    Желтая карточка со стильной красной лентой

    Векторный фон абстрактный многоугольник треугольников.

    Лучи солнца

    Зеленые листья на полосатом фоне

    Осенний фон с желтыми листьями. Обратно в школу. Векторная иллюстрация

    Саншайн

    Чикунгунья, лихорадка Денге, Желтая лихорадка и Зика

    Чикунгунья, Лихорадка Денге, Желтая лихорадка и Зика — болезни, переносимые комарами, которые передаются человеку при дневном укусе. Комары Aedes aegypti и Aedes albopictus (см. Рисунки ниже).Эти комары по состоянию на январь 2018 года НЕ присутствуют в округе Саттер или округе Юба.

    Лихорадка денге
    Существует два типа заболеваний, которые могут возникнуть в результате заражения вирусом денге: денге и тяжелая форма денге. Денге вызывает высокую температуру, сильные головные боли и боли в суставах. Это заболевание может прогрессировать до геморрагической лихорадки, во время которой у пациентов наблюдается усиление кровотечений и постоянная рвота. Если не лечить, это может прогрессировать до шока и смерти. На сегодняшний день в Калифорнии не выявлено ни одного местного случая лихорадки денге.Однако многие путешественники заразились этой болезнью в других странах, где денге является эндемическим заболеванием, а затем вернулись в США, заболев этим вирусом. Если те, кто возвращается в США с болезнью, живут в районах, где обнаружены комары-переносчики, эти комары могут подхватить ее, питаясь инфицированными людьми, а затем передать ее другим через свою деятельность по кормлению кровью.

    Зика
    Зика — вирус, переносимый комарами, проявляющийся в легкой лихорадке, сыпи, боли в суставах и покраснении глаз.Вирус Зика также может передаваться от человека к человеку при половом контакте с инфицированным партнером. У большинства инфицированных людей симптомы отсутствуют. Если симптомы действительно возникают, они начнутся через 3-7 дней после заражения человека. Вспышки вируса Зика произошли в регионах Африки, Юго-Восточной Азии, островов Тихого океана, Карибских островов, Южной и Центральной Америки и Мексики. Список пострадавших стран продолжает расширяться. Недавно местная передача наблюдалась во Флориде и Техасе. Центры по контролю и профилактике заболеваний выпустили предупреждение о вирусе Зика.Предупреждение связано с сообщениями о матерях, инфицированных вирусом Зика, рожающих детей с микроцефалией. Исследователи все еще открывают новые симптомы и эффекты, вызываемые вирусом Зика, особенно у развивающихся плодов. Комар, способный передавать вирус Зика, в настоящее время не встречается в округах Саттер и Юба. Выполните поиск по интерактивной карте мира CDC, чтобы увидеть рекомендации по перемещению вируса Зика в это место.
    Микроцефалия — это врожденный дефект, приводящий к аномально маленькой голове (см. Фото) и недоразвитому мозгу.Беременным женщинам и женщинам, пытающимся забеременеть, не следует ездить в страны, где продолжается передача вируса Зика, переносимого комарами. До сих пор в Калифорнии заражение вирусом Зика было зарегистрировано только у людей, которые были инфицированы во время поездок за пределы Соединенных Штатов или в результате полового контакта с инфицированным путешественником. На сегодняшний день в Калифорнии не было случаев передачи вируса Зика через комары. Этот информационный бюллетень CDC поможет вам больше узнать о вирусе Зика.

    Для получения дополнительной информации загрузите нашу брошюру о вирусе Зика.

    Чикунгунья
    Чикунгунья — инфекционное заболевание, которое характеризуется острой лихорадкой и сильной болью в суставах. Наиболее частые симптомы — лихорадка и болезненные ощущения в суставах рук и ног. Другие симптомы могут включать головную боль, мышечную боль, отек суставов или сыпь. Симптомы обычно появляются через 3-7 дней после укуса инфицированного комара. Это еще одна болезнь, которая распространяется по всему миру и может прийти сюда через инфицированных путешественников, возвращающихся в районы Калифорнии, где живут комары, способные распространять ее среди других людей.

    Желтая лихорадка
    Желтая лихорадка может вызвать лихорадку, желтуху, печеночную и почечную недостаточность. Большинство больных желтой лихорадкой госпитализируются. Вакцины против желтой лихорадки ЕСТЬ доступны и настоятельно рекомендуются людям, путешествующим в страны, где присутствует желтая лихорадка, например, в Африку и Южную Америку. К счастью, вакцины против желтой лихорадки очень эффективны. Надеюсь, исследователи смогут разработать вакцины от денге, зика и чикунгуньи.

    Просмотрите следующие статьи ниже или посетите веб-сайт Центров по контролю и профилактике заболеваний для получения дополнительной информации об этих заболеваниях. Все статьи доступны в английском и испанском форматах.

    http://www.cdc.gov/zika/pdfs/control_mosquitoes_chikv_denv_zika.pdf
    http://www.cdc.gov/zika/pdfs/control_mosquitoes_chikv_denv_zika_spanish.pdf

    http://www.cdc.gov/chikungunya/pdfs/fs_mosquito_bite_prevention_us.pdf
    http://www.cdc.gov/zika/pdfs/fs_mosquito_bite_prevention_travelers_spani…

    http://www.cdc.gov/chikungunya/pdfs/Arbovirus_outbound-508_072115-11×14.pdf
    http://www.cdc.gov/chikungunya/pdfs/arbovirus_outbound_11x14_508_spanish …

    http://www.cdc.gov/chikungunya/pdfs/arbovirus_inbound_11x14_508.pdf
    http://www.cdc.gov/chikungunya/pdfs/arbovirus_inbound_11x14_508_spanish.pdf

    Culicidae) от симпатрических сестринских видов, не являющихся переносчиками, Aedes lilii

    Абстрактные

    Введение

    Желтая лихорадка продолжает оставаться проблемой в странах Африки к югу от Сахары, где происходят неоднократные эпидемии.Комар Aedes bromeliae является основным переносчиком желтой лихорадки, но его нельзя легко отличить от его не векторных зоофильных сестринских видов Ae . lilii по морфологическим признакам. Сообщалось о генетических различиях между антропофильными Ae . бромелий и зоофильных Ae . lilii и между лесными и домашними популяциями. Однако из-за применения различных молекулярных маркеров и неперекрывающихся популяций, использованных в предыдущих исследованиях, интерпретация разграничения видов неясна.

    Методология / основные выводы

    последовательности ДНК были получены из образцов Ae . simpsoni s.l. из Республики Бенин, Танзании и Уганды для двух ядерных генов аполипофорина 2 ( apoLp2 ) и цитохрома p450 ( CYPJ92 ), рибосомной внутренней транскрибируемой спейсерной области ( ITS ) и митохондриальной цитохром-с-оксидазы ( COI). ) область штрих-кодирования. Ядерные гены apoLp2 и CYPJ92 не могли различать виды Ae . bromeliae и Ae . lilii из-за сортировки по наследственным линиям, в то время как данные последовательности ITS обеспечили четкое топологическое разделение филогении. Было показано, что стандартная область штрих-кодирования COI подвержена интрогрессии видов и неспособна четко различать два таксона. Здесь мы представляем надежный прямой основанный на ПЦР метод дифференциации векторных видов Ae . bromeliae из его изоморфного, симпатрического и небиомедицинского важного сестринского таксона, Ae . lilii , на основе региона ITS . Используя проверку молекулярных видов, мы описываем новые незрелые среды обитания для Ae . lilii и сообщают как о симпатрических, так и о аллопатрических популяциях. Тогда как только Ae . lilii находится в Республике Бенин и только Ae . bromeliae в Танзании, оба вида симпатрические в Уганде.

    Выводы / Значение

    Наш точный метод идентификации позволит осуществлять информированное распространение и подробные экологические исследования, которые облегчат оценку риска арбовирусных заболеваний и разработку будущих целевых средств борьбы с переносчиками.

    Сведения об авторе

    В Африке вспышки эпидемии желтой лихорадки продолжаются, несмотря на наличие эффективной вакцины. Эффективное понимание эпидемиологии болезней и борьбы с ними требует способности надежно определять переносчиков желтой лихорадки. Комар Ae . bromeliae , компетентный переносчик вируса желтой лихорадки, не может быть надежно морфологически дифференцирован от родственных ему видов Ae . lilii , который не кусает людей и, следовательно, не переносит желтую лихорадку.Секвенирование ДНК четырех молекулярных маркеров позволило сравнить их эффективность при различении этих видов. Мы обнаружили, что митохондриальная область штрих-кодирования цитохром с оксидазы ( COI ) и ядерный аполипофорин 2 ( apoLp2 ) и цитохром p450 ( CYPJ92 ) не смогли надежно различить эти виды. Напротив, генетическая вариация во внутренней транскрибируемой спейсерной области ( ITS ) могла подтвердить вектор Ae . bromeliae и не-вектор Ae . lilii как отдельный вид. Основываясь на различиях последовательностей ITS , мы разработали надежный молекулярный метод для идентификации вектора Ae . bromeliae от сестринского вида Ae . Лилия . Следовательно, мы обнаружили, что эти виды используют одни и те же среды обитания личинок, включая банан, кокоям и Dracena spp . в Уганде. Тогда как только Ae . lilii , по всей видимости, присутствует в Бенине и только Ae . bromeliae в Танзании, мы подтверждаем, что оба вида встречаются в Уганде. Надежное определение видов будет способствовать более подробным исследованиям распространения, экологии и статуса переносчиков, что имеет важное значение для оценки риска болезней и борьбы с комарами.

    Образец цитирования: Bennett KL, Linton Y-M, Shija F, Kaddumukasa M, Djouaka R, Misinzo G, et al. (2015) Молекулярная дифференциация вектора африканской желтой лихорадки Aedes bromeliae ( Diptera : Culicidae ) от его симпатрических не векторных сестринских видов, Aedes lilii .PLoS Negl Trop Dis 9 (12): e0004250. https://doi.org/10.1371/journal.pntd.0004250

    Редактор: Майкл Дж. Турелл, Медицинский научно-исследовательский институт инфекционных болезней армии США, СОЕДИНЕННЫЕ ШТАТЫ

    Поступила: 26 июля 2015 г .; Одобрена: 29 октября 2015 г .; Опубликовано: 7 декабря 2015 г.

    Это статья в открытом доступе, свободная от всех авторских прав, и ее можно свободно воспроизводить, распространять, передавать, модифицировать, надстраивать или иным образом использовать в любых законных целях.Работа сделана доступной под лицензией Creative Commons CC0, выделенной в общественное достояние.

    Доступность данных: Все файлы последовательностей доступны в базе данных GenBank (инвентарный номер (а) KT998333- KT998452).

    Финансирование: Эта работа была поддержана Африканской премией Королевского общества и Leverhulme Trust (AA110092) и стипендией PhD для KLB, финансируемой Советом по исследованиям природной среды [NE / H525170 / 1, NE / 1528134/1, NE / J500057 / 1]. Эта рукопись была подготовлена ​​в то время, когда YML проводил награду Национального исследовательского совета (NRC) Research Associateship Award в Исследовательском институте армии Уолтера Рида.Публикуемый материал отражает точку зрения авторов и не должен толковаться как представляющий точку зрения Министерства армии или Министерства обороны. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили, что конкурирующих интересов не существует.

    Введение

    Правильная идентификация видов переносчиков, участвующих в передаче болезней, передаваемых комарами, имеет основополагающее значение для прогнозирования вспышек болезней, определения общего риска для населения и целенаправленных мер борьбы.Несмотря на эту необходимость, надежная идентификация комаров во многих случаях проблематична, включая важный с медицинской точки зрения комплекс Aedes simpsoni . Этот комплекс включает три известных вида, включая Ae . simpsoni , Ae . lilii и Ae . бромелиевые . Среди этих трех видов Ae . bromeliae — важный переносчик вируса желтой лихорадки (YFV) и, возможно, других арбовирусов [1].Заболеваемость желтой лихорадкой увеличилась в результате урбанизации и изменений в политике общественного здравоохранения [2, 3]. Бремя желтой лихорадки в Африке оценивается в 130 000 случаев в год, 85 000 из которых приводят к летальному исходу, несмотря на доступность вакцины [4]. После массовых кампаний иммунизации в начале 20 века, YFV была успешно сокращена в целевых странах. Однако вспышки YFV вызывают повышенное внимание. В Западной Африке 13 из 14 стран, о которых известно, что у них есть ЯС, в настоящее время регулярно регистрируют случаи заболевания, и с 2000 г. в них наблюдаются эпидемии [5, 6].Дальнейшее беспокойство вызывает идентификация нового генотипа YFV, связанного с недавними вспышками, включая первую зарегистрированную вспышку в Кении, Восточная Африка (1992–1993 гг.) [7]. Связанные генотипы также были зарегистрированы в Судане в 2003 и 2005 годах, а совсем недавно в северной Уганде в 2010 году [8–10]. Хотя изучению эпидемиологии желтой лихорадки было уделено много внимания [11], о комарах-переносчиках известно относительно мало.

    Десять видов в настоящее время известны в пределах более широкой группы Симпсони (Huang 2004).Внутри этой группы Теобальд [12–14] первоначально описал три вида, принадлежащих к комплексу Симпсони ( Ae . simpsoni , Ae . bromeliae и Ae . lilii ). Несмотря на эти отдельные обозначения видов, многие энтомологи называли всех simpsoni -подобных комаров в этом комплексе номинальным видом, Ae . simpsoni [15–21]. В Уганде было обнаружено, что некоторые популяции Ae . simpsoni s.l. были антропофильными и привлекались человеческой наживкой, тогда как других не привлекал человек, несмотря на местное изобилие [20]. Кроме того, москиты, собранные из зоофильных и антропофильных популяций, показали разные предпочтения в кормлении в лаборатории, с предпочтением грызунов или людей соответственно [20]. Эти результаты привели к повторному исследованию морфологии комаров, и впоследствии Хуанг [22, 23] предоставил полное описание составляющих членов комплекса Симпсони, проанализировал их экологию и обратил внимание на неправильное использование прежней номенклатуры. Aedes simpsoni , о котором сообщалось только в Южной Африке и Свазиленде, не участвует в передаче болезней человека [22, 23]. Переносчик антропофильной желтой лихорадки Ae . bromeliae широко распространена на африканском континенте [23]. Напротив, Ae . lilii , о котором ранее сообщалось только из Судана, Эфиопии и Уганды, никогда не сообщалось об укусе человека и, таким образом, не считается причастным к передаче болезни [22, 23]. Хотя мы знаем, что эти три вида имеют разное распространение, укусы и переносчики, их необходимо полностью охарактеризовать.Понимание экологии и эпидемиологии требует, чтобы виды можно было отличить друг от друга. Однако разногласия по поводу таксономии комаров означают, что антропофильное заболевание является переносчиком Ae . bromeliae нельзя надежно отличить от его зоофильного сестринского вида Ae . lilii [24, 25].

    Крупномасштабные детальные исследования комплекса Симпсони, проведенные Хуангом [22, 23, 26], показали, что Ae . simpsoni s.s.можно отличить от Ae . bromeliae и Ae . lilii в том, что у него простые коготки на средних лапках, в отличие от зубчатых когтей на средних лапках, присутствующих в последних двух таксонах. Aedes simpsoni также можно легко отличить от сородичей по отчетливому типу чешуек тарсомера [22, 25]. Однако Джапп и Кемп [24] сообщили об изменении морфологии копытца на предплюсне у Ae . simpsoni и Ae . bromeliae , и поставили под сомнение достоверность этого диагностического признака.В данном исследовании мы сосредоточили внимание на более распространенных таксонах комплекса — Ae . bromeliae и Ae . Лилия . Эти сестринские таксоны иногда могут быть надежно идентифицированы морфологически на основе структуры полос тарсомеров, но только тогда, когда этот признак проявляется в крайних точках ее ареала, поскольку схемы полосатости перекрываются между видами [25]. Lutwama & Mukwaya [25] поставили под сомнение полезность структуры полос тарсомеров в качестве диагностического признака для Ae . bromeliae и Ae . Лилия . Они наблюдали изменение чешуйчатого орнамента в почти непрерывном масштабе и обнаружили, что потомство от одной матери можно идентифицировать как Ae . bromeliae или Ae . lilii на основании этого морфологического признака.

    Ненадежность и практичность использования морфологических методов для рутинной полевой идентификации в комплексе Симпсони привели к попыткам определить границы видов с помощью молекулярных методов.При исследовании комплекса Симпсони, за исключением распространенного южнее Ae . simpsoni , Mukwaya и др. . [27] обнаружили, что антропофильные популяции из Кении и Уганды образуют отдельную генетическую кладу, отдельную от несимпатрических и неантропофильных популяций из Уганды и Нигерии, на основе некодирующей внутренней транскрибируемой спейсерной области ( ITS ) рибосомной ДНК. В этом исследовании виды были обозначены в соответствии с обоими предпочтениями в отношении кормления кровью (потому что Ae . lilii является зоофильным, тогда как Ae . bromeliae ( — человеческие векторы)) и на полосах тарсомеров, которые были характерны для некоторых образцов [22, 23, 27]. Недавно Walter et al . [28] предположили наличие Ae . bromeliae и Ae . lilii в симпатрии в Рабаи, Кения, на основе генетических различий между домашними / перидомашними и лесными популяциями. Однако, как эти предполагаемые виды соотносятся с теми, которые охарактеризованы Mukwaya et al .[27] остается неясным, поскольку они использовали разные молекулярные маркеры; два ядерных гена, аполипофорин 2 и цитохром p450 ( CYPJ92 ).

    Участок гена цитохром с-оксидазы ( COI ) длиной 658 п.н. был широко принят в качестве стандарта штрих-кодирования ДНК для идентификации видов, поскольку он демонстрирует высокую полезность для различения близкородственных таксонов, а также для определения филогеографических групп внутри видов [29–2]. 31]. Однако единственное использование митохондриальной ДНК для определения границ видов подвергается сомнению из-за возможности развития и интрогрессии псевдогенов, которые могут ограничивать способность маркеров мтДНК разрешать близкородственные виды [32, 33].Комбинированный анализ митохондриальных и ядерных генов может улучшить филогенетическое разрешение, поскольку эти маркеры развиваются с разной скоростью и, таким образом, нацелены на разные уровни филогенетического дерева [34]. Другим кандидатом на штрих-кодирование является ядерный внутренний транскрибируемый спейсер ( ITS ) цистрона рибосомного гена, который включает гены 18S, 5.8S и 28S, внешнюю спейсерную область и две внутренние спейсерные области ITS1 и ITS2 [35]. ]. Области ITS развиваются с высокой скоростью при отсутствии функциональных ограничений [36, 37].Поскольку они тандемно повторяются в геноме, спейсерные области ITS также подвергаются согласованной эволюции, посредством которой паралоги гомогенизируются посредством генетического обмена [36, 37]. Следовательно, паралоги остаются генетически подобными внутри видов, демонстрируя при этом высокий уровень межвидовой дивергенции [37]. Хотя не во всех таксономических группах, ITS может различать сестринские виды в большом количестве случаев и широко используется для разграничения близкородственных комаров в комплексах Anopheles [35, 38–42].

    Мы стремимся расширить предыдущие работы по генетической дифференциации Ae . bromeliae и Ae . lilii в комплексе Симпсони, определив, как предполагаемые виды идентифицированы Mukwaya et al . [27] и Уолтер и др. . [28] относятся друг к другу. Мы достигаем этого путем секвенирования тех же образцов комаров по ранее используемым молекулярным маркерам ( apoLp2 , CYPJ92 и ITS ). Кроме того, мы смогли оценить полезность различных молекулярных маркеров, включая области ITS и COI , при определении видовых границ.Мы применяем эти результаты для разработки метода молекулярной идентификации, основанного на вариации в области ITS , чтобы отличить вектор болезни Ae . bromeliae из сестринских видов, не являющихся переносчиками, Ae . Лилия . Применение этого метода к комарам из Бенина, Уганды и Танзании позволило нам получить надежные данные об их экологии и распространении.

    Методы

    Сбор проб

    комаров комплекса Симпсони были собраны в виде личинок в естественных местах размножения в Танзании (n = 36), Уганде (n = 50) и Республике Бенин (n = 24) в местах, указанных на рис. 1 и в таблице S1, с 2009 по 2014 г.Отобранные незрелые местообитания включали пазухи листьев Musa spp . (банан), Colocasia spp . (кокоям / таро), Dracaena spp . и в дуплах деревьев. Чтобы избежать искажения набора данных братьями и сестрами, каждое отдельное местообитание рассматривалось как отдельная коллекция, и для генетического анализа брали только одну особь из каждой коллекции. По возможности, неполовозрелых особей выращивали до взрослых особей; в противном случае личинки, предназначенные для анализа ДНК, хранили в 95% этаноле. Взрослых особей обезвоживали диоксидом кремния для оптимального сохранения ДНК и либо хранили в капсулах BEEM, либо закрепляли булавками.Личинки сохраняли в этаноле для последующего извлечения ДНК. Все взрослые комары были идентифицированы как принадлежащие к комплексу Симпсони с использованием морфологического идентификационного ключа Хуанга [26] и их подвыборки, а также таксонов внешней группы, включая Ae . aegypti и Ae . aegypti formosus были морфологически подтверждены доктором Yiau-Min Huang.

    Рис 1. Карта точек отбора проб для Ae . bromeliae (красные кружки) и Ae . lilii (синие кружки), использованный в текущем исследовании, включая образцы из Mukwaya et al . [27] и Ле Гофф и др. . [43].

    Также отображаются ранее описанные точки выборки для Ae . bromeliae (красные треугольники), Ae . lilii (синие треугольники) и Ae . simpsoni s.s (зеленые треугольники) на основе морфологической идентификации, взятой из Хуанга [23]. Карта была создана в QGIS (команда разработчиков QGIS) на платформе Natural Earth.

    https://doi.org/10.1371/journal.pntd.0004250.g001

    Экспериментальные процедуры

    ДНК

    была извлечена из целых личинок или одной ноги взрослого комара с использованием модифицированного фенол-хлороформного метода по Surendran et al . [44]. Сорок особей комплекса Симпсони были амплифицированы и секвенированы для области митохондриального гена COI с универсальными праймерами LCO1490 (5’GGTCAACAAATCATAAAGATATTGG’3) и HCO2198 (5’TAAACTTCAGGGTGACCAAAAAATCA’3 с использованием протокола 45) [45] для штрих-кода жизни (http: // barcoding.si.edu/dnabarcoding.htm). Peridomestic Aedes aegypti , собранный из искусственного контейнера в Танзании, также был секвенирован на COI в качестве внешней группы.

    Внутренние транскрибированные спейсерные области 1 и 2 были амплифицированы у шести человек из Уганды и трех человек из Танзании, которые были отобраны для представления генетического разнообразия, которое мы наблюдали в гене COI . Это было достигнуто с помощью праймеров 18SFHIN и CP16 (5’-GTAAGCTTCCTTTGTACACACCGCCCGT-3 ’и 5’-GCGGGTACCATGCTTAAATTTAGGGGGTA-3’, соответственно) [46], которые использовали Mukwaya et al .[27]. Для создания продуктов ПЦР использовали 1 единицу высокоточной ДНК-полимеразы MyFi (Bioline, UK), 2X реакционного буфера MyFi, 0,8 мкМ прямой и обратный праймер и 1–10 нг матричной ДНК в следующих условиях при 30% -ной скорости изменения; 95 ° C в течение 3 минут с последующими 30 циклами 95 ° C в течение 30 секунд, 58 ° C в течение 45 секунд и 72 ° C в течение 45 секунд без окончательного продления.

    Тринадцать индивидуумов, включая восемь таких же индивидуумов, секвенированных в области ITS , также были секвенированы на участки ядерных генов аполипофорина 2 ( apoLp2) и цитохрома p450 ( CYPJ92) , впервые описанных Брауном и др. .[47] и использовался Уолтером и др. . [28] в комплексе Симпсони. Это включало проверенные Aedes aegypti formosus , собранные из дупла в Танзании, для использования в качестве внешней группы, как это было в случае с Walter et al . [28]. Другой маркер, короткоцепочечная дегидрогеназа-редуктаза ( SDR ), также использовался Уолтером и др. . [28] в комплексе Симпсони не использовался, поскольку он давал множественные неспецифические полосы при амплификации. Продукты ПЦР получали, как описано в Walter et al .[28]. Продукты ПЦР очищали с помощью набора GenElute PCR clean up kit (Sigma-Aldrich, UK) и секвенировали по Сэнгеру в прямом и обратном направлениях с использованием праймеров для амплификации. Последовательности генерировали с помощью набора для циклического секвенирования BigDye Terminator v3.1 (Applied BioSystems, UK) на автоматическом секвенаторе Applied BioSystems 3730.

    Продукты ITS клонировали с использованием набора для клонирования P-GEM (Promega, UK) в соответствии с инструкциями. Трансформанты подвергали сине-белому скринингу, а колонии со вставками сохраняли в буфере ТЕ для амплификации ПЦР.Универсальные праймеры M13 (5’-TGTAAAACGACGGCCAGT-3 ’и 5’-CAGGAAACAGCTATGAC-3’) [48] использовали для амплификации клонированных продуктов ITS в следующей 13 мкл реакции; 1,25 единиц ДНК-полимеразы BIOTAQ (BioLine, Великобритания), 1 х реакционный буфер NH 4 , 2 мМ раствор MgCl 2 , 0,8 мМ dNTP и 0,5 мкМ прямой и обратный праймер. Условия термоциклера составляли 95 ° C в течение 2 минут, затем 95 ° C в течение 15 секунд, 60 ° C в течение 30 секунд и 72 ° C в течение 30 секунд в течение 35 циклов и окончательное увеличение до 72 ° C в течение 10 минут.Для каждого индивидуума секвенировали как минимум два и максимум четыре клона.

    Клонированные последовательности ITS были выровнены с данными о последовательностях Mukwaya et al .’s [27] из нескольких мест в Африке (таблица S1) и Le Goff et al. .’s [43] из двух Ae . bromeliae , происходящие с острова Майотта в Индийском океане, доступны в GenBank (KF135509-10) с использованием программы Geneious v5.4.7 [49]. На основе этого выравнивания были разработаны праймеры для различения видов.Несколько предполагаемых видоспецифичных праймеров были испытаны в широком диапазоне условий ПЦР. Однако единственные праймеры, которые работали эффективно, генерировали видоспецифичные продукты ПЦР, которые различались примерно на 30 п.н. Из-за этой небольшой разницы в размерах мы рекомендуем использовать пары праймеров, специфичные для каждого вида, в отдельных реакциях ПЦР. Неспецифическая полосатость была особенностью всех протестированных праймеров, что, как мы подозреваем, может быть результатом переменной длины отступа среди копий ITS у человека.Хотя протоколы ПЦР были оптимизированы для уменьшения неспецифических полос, некоторые дополнительные полосы могут быть видны, но не заслоняют амплификацию / неамплификацию видоспецифичного продукта ПЦР.

    Разработанные праймеры вложены в область ITS1-2 ; поэтому продукты ПЦР, охватывающие эту область, сначала были получены с праймерами 18SFHIN и CP16, как описано выше. Эти продукты ПЦР очищали с помощью набора для очистки GenElute PCR (Sigma, UK), и 0,5 мкл использовали в качестве матрицы в 25 мкл реакции с 0.6 единиц полимеразы Go Taq Hot Start (Promega, Великобритания), 1 реакционный буфер NH 4 , 1 мМ раствор MgCl 2 , 0,8 мМ dNTP и 0,5 мкМ прямой и обратный праймер. Праймеры, разработанные для амплификации 591 п.н. в Ae . bromeliae только были BRO-F (5’-CCTGGCCAGTGGCCA-3 ’) и BRO-R (5’-GTGCACACCACTGA-3’). Амплификация была достигнута с помощью протокола приземной ПЦР; этап инициализации 95 ° C в течение 3 минут, затем 95 ° C в течение 30 секунд, 82 ° C в течение 45 секунд и 72 ° C в течение 1 минуты в течение 5 циклов, затем 30 циклов 95 ° C в течение 30 секунд, 64 ° C в течение 45 секунд и 72 ° C в течение 1 минуты, а затем окончательное расширение до 72 ° C в течение 7 минут.Праймеры, разработанные для амплификации области 620 п.н. в Ae . Только lilii были LIL-F (5’CTGATGCACTGGCCTCAAAG’3) и LIL-R (5’TCAACCGCCGTGCGTG’3). Условия термоциклирования: 95 ° C в течение 3 минут, затем 95 ° C в течение 30 секунд, 78 ° C в течение 45 секунд, 72 ° C в течение 1 минуты в течение 10 циклов, затем 95 ° C в течение 30 секунд, 70 ° C в течение 45 секунд. , 72 ° C в течение 1 минуты для 20 циклов и заключительный этап наращивания при 72 ° C в течение 7 минут. Амплифицированные продукты обрабатывали на 1,2% агарозном геле для электрофореза для определения наличия или отсутствия полос ДНК ожидаемого размера.Положительные и отрицательные виды контроля использовали во всех реакциях ПЦР. Последовательности доступны в GenBank (KT998333-KT998452).

    Анализ данных

    Выравнивание последовательностей

    было достигнуто с помощью Geneious v5.4.7 [49]. Для наборов данных apoLp2 и CYPJ92 файлы были подготовлены с использованием seqPHASE [50], а затем PHASE v2.1 использовалась для определения гаплотипов [51]. Гаплотипы Ae . aegypti formosus внешних групп были определены путем сопоставления с соответствующими наборами данных для Ae . aegypti в Brown et al . [47] и с помощью программы PHASE. Последовательности для двоих Ae . aegypti от Brown et al . [47] использовались как внешние группы в сочетании с данными, полученными в ходе настоящего исследования. Набор данных COI был выровнен с двумя последовательностями COI из Ae . bromeliae с острова Майотта в Индийском океане, доступного в GenBank (KF135496-97) [43].

    Соседние деревья (NJ) были построены в MEGA 6 [52], как в Mukwaya et al .[27] и Уолтер и др. . [28] с использованием наилучшей доступной модели замещения, выбранной JModelTest [53, 54]. Для построения деревьев штата Нью-Джерси для COI была использована модель Тамура-Неи с одинаковыми скоростями для разных участков. Модель Кимуры с двумя параметрами (K80) с одинаковыми скоростями среди сайтов была использована для последовательностей ITS , а модель K80 с 0,8 гамма-распределенными сайтами была использована для построения деревьев для apoLp2 и CYPJ92 . Для всех генетических маркеров недостающие данные, включая индели, были исключены из анализа.Топологическая поддержка была определена через 1000 повторений начальной загрузки. Дерево последовательностей ITS было построено без внешней группы, потому что высокий уровень дивергенции между внешней группой и внутренними группами представляет проблему для выравнивания последовательностей. Две последовательности ITS из Ae . bromeliae из Mayotte [43] не были включены в дерево штата Нью-Джерси, потому что они не перекрывались с последовательностями, сгенерированными здесь.

    Иерархический AMOVA был выполнен на данных последовательности ITS , сгенерированных в этом исследовании вместе с Mukwaya et al .Последовательности [27] (n = 69) в Arlequin v3.5 [55]. Иерархический AMOVA был также выполнен на последовательностях apoLp2 (n = 13) и CYPJ92 (n = 13), созданных в этом исследовании.

    Результаты

    Филогенетический анализ

    Четыре замены с фиксированной точкой и восемь инделей различной длины наблюдались у разных видов в первых 300 п.н. выравнивания последовательностей ITS . Дерево соседних соединений последовательностей ITS выявило две основные клады с поддержкой бутстрапа 98% (рис. 2).Как сообщалось ранее, 46 последовательностей из Mukwaya et al . [27] сгруппированы в ту или иную из двух клад в зависимости от их предполагаемых кормовых предпочтений хозяина, которые они соответственно обозначили как Ae . bromeliae (антропофильный) и Ae . lilii (неантропофильный). Последовательности всех девяти особей комплекса Симпсони из этого исследования также принадлежали к той или иной из этих клад, поэтому мы идентифицировали их как Ae . bromeliae или Ae . lilii со ссылкой на Mukwaya et al. .’s [27] Обозначение вида на основе ITS .

    Рис. 2. Дерево соседних соединений данных последовательности ITS с метками, окрашенными в соответствии с обозначением вида на основе ITS , как в Mukwaya et al . [27].

    Красные ярлыки обозначают Ae . bromeliae , а синие метки — Ae . Лилия . Последовательности из Mukwaya et al .[27] (+) аннотированы. Показаны значения поддержки бутстрапа выше 55%.

    https://doi.org/10.1371/journal.pntd.0004250.g002

    Комары, собранные в Каньяваре, Бундибугйо (регион Бвамба) и Наджембе в Уганде, представляли кладов ITS . Для сравнения, особи, собранные из Танзании, строго объединены в линию ITS из Ae . бромелиевые . AMOVA обнаружила, что почти все различия в последовательностях можно объяснить различиями между видами (92.65%), в то время как различия между популяциями внутри групп и внутри популяций незначительны (0,25% и 7,19% соответственно).

    Секвенирование индивидов как по ITS , так и по ядерным генам apoLp2 и CYPJ92 позволило нам сравнить обозначение видов на основе ITS Mukwaya et al . [27] с данными Уолтера и др. . [28]. Две хорошо поддерживаемые линии наблюдались в деревьях NJ для ядерных генов apoLp2 и CYPJ92 со 100% бутстреп-поддержкой (рис. 3 и 4).Подтверждены лица как Ae . bromeliae или Ae . lilii с использованием области ITS со ссылкой на Mukwaya et al . [27], все попадают в одну кладу для каждого из ядерных генов, apoLp2 и CYPJ92 . Для обоих генных деревьев другая ветвь включает только последовательности лесных видов в Walter et al . [28], которые они называли Ae . Лилия . Иерархический AMOVA показал, что ядерные гены apoLp2 и CYPJ92 не могут эффективно различать Ae . bromeliae и Ae . lilii с только 0,86% и 18,94% генетической изменчивости между группами видов, соответственно. Напротив, наблюдалась относительно высокая генетическая изменчивость среди популяций внутри групп видов (37,04%, 10,28% соответственно) и внутри популяций (62,10%, 70,79% соответственно).

    Рис. 3. Дерево соседних соединений данных последовательности apoLp2 с метками, окрашенными в соответствии с обозначением видов на основе ITS .

    Красные ярлыки обозначают Ae . bromeliae , а синие метки — Ae . Лилия . Последовательности из Walter et al . [28] (*) и Ae . aegypti вне группы (~) из Brown et al . [47] аннотированы. Показаны значения поддержки бутстрапа для веток выше 55%.

    https://doi.org/10.1371/journal.pntd.0004250.g003

    Рис. 4. Дерево соседних соединений данных последовательности CYPJ92 с метками, окрашенными в соответствии с обозначением видов на основе ITS .

    Красные ярлыки обозначают Ae . bromeliae , а синие метки — Ae . Лилия . Последовательности из Walter et al . [28] (*) и Ae . aegypti вне группы (~) из Brown et al . [47] аннотированы. Показаны значения поддержки бутстрапа для веток выше 55%.

    https://doi.org/10.1371/journal.pntd.0004250.g004

    Есть два филогенетических кластера с высокой поддержкой начальной загрузки (90%, 90%) и два со слабой поддержкой начальной загрузки (56% и 43%) в Дерево NJ для митохондрий COI с индивидуумами, склонными к кластеризации в соответствии с географическим происхождением (рис. 5).Последовательности из кластера Майотта с Ae . bromeliae из Танзании. Лица, обозначенные как Ae . bromeliae или Ae . lilii согласно ITS Вариации последовательности имеют тенденцию группироваться по видам в пределах одной и той же клады, но есть три исключения. Один человек из Уганды, демонстрирующий последовательность ITS из Ae . бромелий, кластеров в группе из Ae . lilii , а два человека из Уганды и Бенина, идентифицированные как Ae . lilii , кластер в группе, которая в противном случае состоит из Ae . бромелиевые . Иерархический AMOVA показал, что у гена COI больше генетических вариаций внутри (42,83%) и между популяциями (55,18%), чем между видами (1,99%).

    Рис. 5. Дерево соединения соседей данных последовательности COI с метками, окрашенными в соответствии с обозначением видов на основе ITS .) аннотированы. Показаны значения поддержки бутстрапа для веток выше 55%.

    https://doi.org/10.1371/journal.pntd.0004250.g005

    Идентификация видов и географическое распространение

    На основе фиксированных различий между видами в последовательностях ITS были разработаны видоспецифичные праймеры для амплификации продуктов ПЦР в Ae . bromeliae или Ae . Лилия . Праймеры предназначены для амплификации в Ae . bromeliae не амплифицировал продукт ПЦР из Ae . lilii и наоборот (рис 6). Применение этого метода к 110 образцам Ae . simpsoni s.l. положительно идентифицировал всех индивидов как Ae . bromeliae или Ae . lilii , как подробно описано в Таблице 1. Оба вида используют одни и те же места гнездования в домашних и перидоместических местообитаниях, включая пазухи листьев Musa spp ., Colocasia spp . и Dracena spp . Несмотря на целенаправленные попытки сбора, ни один из видов не был обнаружен в дуплах деревьев для незрелого развития. Оба вида встречаются в симпатрии в Уганде, в то время как только Ae . lilii было собрано из Республики Бенин и Ae . bromeliae был единственным видом, обнаруженным в Танзании (рис. 1).

    Обсуждение

    Здесь мы использовали несколько маркеров, чтобы подтвердить, что есть два близкородственных вида комплекса Симпсони, которые встречаются как аллопатрически, так и симпатрически по всему отобранному диапазону в Африке к югу от Сахары.Эти виды соответствуют Ae . bromeliae и Ae . lilii комплекса Simpsoni, как описано Mukwaya et al . [22, 27]. Мы предполагаем, что третий лесной таксон первоначально был обозначен как Ae . lilii в Walter et al . [28] относится к другому виду, возможно, к другому члену группы Симпсони. Разработка метода идентификации молекулярных видов для вектора YFV Ae . bromeliae и не-вектор Ae . lilii с использованием вариации в области ITS позволило нам впервые сделать надежные выводы об экологии и распространении комаров. Такая информация жизненно важна для полного понимания передачи болезней этими видами.

    Все Ae . simpsoni s.l. протестированные комары попали в одну из двух генетически расходящихся линий ITS . Основываясь на сходстве последовательностей, они напрямую соответствуют двум линиям, обнаруженным Mukwaya et al .[27] и мы следуем их предыдущему обозначению как Ae . bromeliae и Ae . Лилия . Мы считаем их видовое обозначение надежным, поскольку оно основывалось как на морфологии, так и на предпочтениях в питании. Во-первых, несмотря на то, что некоторые особи не могут быть идентифицированы из-за совпадения морфологических признаков, Mukwaya et al . [27] смогли идентифицировать отдельные экземпляры по определяющим признакам рисунка полос тарсомеров ног и морфологии когтей, описанным Хуангом [22, 23].Во-вторых, Mukwaya et al . [27] идентифицировали виды на основе пищевого поведения хозяина; человеческие уловы были использованы для определения антропофильных Ae . bromeliae из неантропофильных Ae . lilii , которые были собраны как личинки, в которых отсутствовали кусающие человека члены комплекса Симпсони. Мы подтверждаем существование Ae . bromeliae и Ae . lilii как два разных вида, поскольку при использовании вариации последовательности ITS они остаются генетически разными по симпатрии в нескольких местах Уганды.

    Наше исследование позволило нам связать работы Mukwaya et al . [27] с данными Уолтера и др. . [28]. Тогда как Мувакья и др. . [27] сосредоточились на поведении при кормлении, Walter et al . [28] обнаружили расхождение между лесными и перидоместными популяциями в прибрежной Кении по трем ядерным генам. Наш филогенетический анализ показывает, что генетическая изменчивость в области ITS не соответствует двум отдельным линиям, обнаруженным у Walter et al .[28]. Оба Ae . bromeliae и Ae . lilii попадают в единую филогенетическую кладу по ядерным генам apoLp2 (аполипофорин 2) и CYPJ92 (цитохром p450). Это согласуется с тем, что эти более медленно эволюционирующие ядерные гены неспособны разрешить недавно дивергированные виды из-за неполной сортировки по клонам [56]. Лесная линия из Кении, обнаруженная ядерными генами apoLp2 и CYPJ92 , четко различается и не имеет общего предкового полиморфизма ни с Ae . bromeliae или Ae . lilii указывает на более отдаленные отношения. Морфологическая идентификация видов комаров, как известно, является сложной задачей, и в пределах более широкой группы Симпсони есть много видов, которые имеют общие морфологические характеристики [26]. Поэтому мы предполагаем, что лесные виды, описанные Walter et al . [28] представляет члена более широкой группы Симпсони, а не комплекса Симпсони. Возможные кандидаты на этот вид, морфологически похожие и известные из Кении, включают Ae . gandaensis , Ae . Вуди , Ae . subargenteus и Ae . sampi [26].

    Маркер штрих-кода митохондриального вида COI также не смог различить эти таксоны, при этом большая часть генетических вариаций возникает между географическими популяциями, а не между видами. При этом неспособность COI различить Ae . bromeliae и Ae . lilii может быть следствием неполной сортировки клонов, филогения предполагает, что это, скорее всего, связано с интрогрессией мтДНК; есть три случая, в которых Ae . бромелий кластеров с Ae . lilii или наоборот, два из которых встречаются в симпатрии в Уганде. Интрогрессия митохондрий довольно распространена между близкородственными таксонами комаров [33]. Учитывая это, а также то, что комары Aedine могут быть особенно предрасположены к NUMT из-за их большого размера генома [57], кажется разумным не полагаться на митохондриальные маркеры для различения видов в этом роде без предварительного подтверждения с помощью дополнительного маркера. Мы обнаружили, что область ITS была единственным маркером, способным надежно разделять виды комплекса Симпсони, и поэтому использовали его для разработки метода идентификации видов, опосредованного ПЦР.Этот метод широко применим в диапазоне Ae . bromeliae и Ae . lilii , кроме южной части Африки. Для использования в этой области метод должен быть изменен с учетом присутствия Ae . simpsoni s.s. Наш метод ПЦР-опосредованной диагностики видов устраняет трудности, связанные с морфологической идентификацией полевых образцов, и, следовательно, предоставляет ценный ресурс медицинским энтомологам, изучающим передачу арбовирусов.

    Наш инструмент идентификации в сочетании с отбором личинок из естественных местообитаний предоставил дополнительную информацию об экологии комплекса Симпсони. В отличие от широкого спектра видов растений, используемых Ae . bromeliae в качестве местообитаний, неполовозрелые особи Ae . lilii были обнаружены только в пазухах Sansevieria spp ., Что свидетельствует о более узком диапазоне незрелых местообитаний [22, 23]. Однако мы обнаружили, что Ae . lilii , как Ae . bromeliae , использовали пазухи растений Musa spp ., Colocasia spp . и Dracena spp ., что позволяет предположить, что места размножения личинок не так ограничены, как сообщалось ранее [22, 23]. Уолтер и др. . [28] предположили, что давление отбора, направленное на использование мест обитания домашних личинок, могло привести к видообразованию в комплексе Симпсони. Это не подтверждается нашими выводами, которые не показали очевидных различий в среде обитания личинок между видами, хотя наша характеристика местообитаний личинок не была исчерпывающей.Поскольку выбор хозяина, по-видимому, является экологическим различием между этими видами, возможно, что дивергентный отбор антропофилии и надежный источник крови, который он обеспечивает, могли привести к дивергенции видов [28, 58].

    Здесь мы показали, что Ae . bromeliae и Ae . lilii распространены в Уганде, где они могут встречаться в симпатриях в перидоместических местообитаниях. Ае . lilii был единственным членом комплекса Simpsoni, собранным в Республике Бенин, где он описан впервые, тогда как только Ae . бромелий собрано в Танзании. Кроме того, данные о последовательности Mukwaya et al. .’s [27] показывают, что комары из Нигерии являются Ae . lilii , а из Кении — Ae . бромелиевые . Таким образом, молекулярные данные согласуются с более ранними морфологическими данными Хуанга [22, 23], что Ae . bromeliae распространен в Восточной Африке (Танзания, Кения, Уганда, Майотта; рис. 1). Эти морфологические данные также указывают на более широкое распространение в Африке к югу от Сахары для Ae . bromeliae (Рис. 1) [22, 23], но было бы разумно подтвердить это с помощью молекулярной идентификации. Однако, учитывая, что Ae . bromeliae имеет тенденцию легко собираться, когда он присутствует, молекулярные данные предполагают, что только Ae . lilii присутствует в Западной Африке (рис. 1). Это различие согласуется с ранними сообщениями о том, что западноафриканское население преимущественно неантропофильно [59]. По нашим предварительным данным о распространении, Ae . bromeliae может быть важным переносчиком желтой лихорадки в Восточной Африке, где YFV был ранее выделен из комплекса Simpsoni и применен в эпидемиях, включая вспышку эпидемии в Эфиопии 1960–1961 годов [59–61]. Для сравнения, другие комары-переносчики, включая Ae . aegypti , Ae . luteocephalus , Ae . furcifer и Ae . taylori может быть более важным для передачи болезни YFV в Западной Африке, где желтая лихорадка была изолирована от этих переносчиков и причастна к вспышкам [59, 62–65].

    Возникающие / повторно появляющиеся арбовирусы, такие как чикунгунья и Зика, вызывают серьезную озабоченность, поскольку они все в большей степени ответственны за катастрофические эпидемии во всем мире [66–72]. Члены группы Simpsoni передают ряд арбовирусов, включая вирусы желтой лихорадки, вирусы Бабанки и Нгари [1]. Ограниченное количество исследований арбовирусов было сосредоточено на передаче болезни в этой группе видов, прогрессу которой препятствует неполное понимание таксономии. Следовательно, существует большая потребность в разрешении молекулярной систематики более широкой группы Симпсони, которую, в свою очередь, следует использовать для разработки методов идентификации видов.В дополнение к исследованиям риска, связанного с арбовирусами, требуется оценка ареалов видов комаров, чтобы связать их с различиями в распределении арбовирусов и / или генотипов арбовирусов, например, наблюдаемых при желтой лихорадке [59]. Улучшенные методы идентификации также облегчат изучение пищевого поведения и генетической интрогрессии, которые важны для понимания рисков возникновения зоонозных заболеваний. Например, интрогрессия, которую мы наблюдали между Ae . lilii и Ae . bromeliae может увеличивать склонность Ae . lilii , чтобы питаться людьми, что приводит к увеличению передачи зоонозов людям. Прецедент для этого можно увидеть в Culex pipiens в Северной Америке, где смешение генетических форм молестуса и pipiens (преимущественно человека и птицы, соответственно) увеличивает передачу вируса Западного Нила человеку. С помощью нашего инструмента молекулярной идентификации теперь можно делать широкий спектр выводов по экологии и эпидемиологии, которые следует использовать для оценки риска заболеваний и предоставления базовой информации для контроля над популяциями переносчиков.

    Благодарности

    Авторы благодарны полевым группам Угандийского института вирусных исследований и Международного института тропического сельского хозяйства за их помощь в исследованиях.

    Вклад авторов

    Задумал и спроектировал эксперименты: CW GM YML KLB. Проведены эксперименты: KLB. Проанализированы данные: KLB. Предоставленные реагенты / материалы / инструменты анализа: KLB CW YML FS RD MK JL YMH LBM MR ET. Написал статью: KLB CW YML.

    Список литературы

    1. 1.Mutebi JP, Crabtree MB, Kading RC, Powers AM, Lutwama JJ, Miller BR. Комары Западной Уганды. J Med Entomol. 2012. 49 (6): 1289–306. pmid: 23270157
    2. 2. Гублер DJ. Возрождение трансмиссивных болезней как глобальная проблема здравоохранения. Emerg Infect Dis. 1998 июль-сентябрь; 4 (3): 442–50. pmid: 9716967
    3. 3. Томори О. Желтая лихорадка в Африке: влияние на общественное здоровье и перспективы борьбы в 21 веке. Биомедика. 2002. 22 (2): 178–210. pmid: 12152484
    4. 4.Гарске Т., Ван Керхове М.Д., Яктайо С., Ронво О., Льюис Р.Ф., Staples JE и др. Желтая лихорадка в Африке: оценка бремени болезней и воздействия массовой вакцинации на основе данных о вспышках и серологических данных. PLoS Med. 2014; 11 (5): e1001638. pmid: 24800812
    5. 5. КТО. Глобальное предупреждение и ответ: ситуация в Западной Африке. http://www.who.int/csr/disease/yellowfev/westafrica/en/ 2015.
    6. 6. Робертс Л. Возрождение желтой лихорадки в Африке побуждает к контратаке.Наука. 2007; 316 (5828): 1109–. pmid: 17525307
    7. 7. Эллис Б.Р., Барретт ADT. Загадка желтой лихорадки в Восточной Африке. Rev Med Virol. 2008. 18 (5): 331–46. pmid: 18615782
    8. 8. Onyango CO, Grobbelaar AA, Gibson GVF, Sang RC, Sow A, Swanepoel R et al. Вспышка желтой лихорадки, Южный Судан, 2003 г. Emerg Infect Dis. 2004. 10 (9): 1668–70. pmid: 15498174
    9. 9. Гулд Л.Х., Осман М.С., Фарнон Е.С., Гриффит К.С., Годси М.С., Карч С. и др. Вспышка желтой лихорадки с одновременной передачей вируса чикунгунья в Южном Кордофане, Судан, 2005 г.Trans R Soc Trop Med Hyg. 2008. 102 (12): 1247–54. pmid: 18502458
    10. 10. Вамала Дж. Ф., Малимбо М., Окот К. Л., Атаи-Оморуто А. Д., Тенива Е., Миллер Дж. Р. и др. Эпидемиологические и лабораторные характеристики вспышки желтой лихорадки на севере Уганды, октябрь 2010 г. — январь 2011 г. Int J Infect Dis. 2012; 16 (7): e536 – e42. pmid: 22575876
    11. 11. Барретт ADT, Хиггс С. Желтая лихорадка: болезнь, которую еще предстоит победить. Анну Рев Энтомол. 2006. 52 (1): 209–29.
    12. 12.Теобальд Ф.В. Новый Stegomyia от трансвааля. Энтомолог. 1905 (38): 101–4.
    13. 13. Теобальд Ф.В. Монография о Culicidae или комарах. Британский музей естественной истории, Лондон; 1910.
    14. 14. Теобальд Ф.В. Уганда Culicidae , включая тринадцать новых видов. In Novae Culicidae , часть 1. Уай, Кент; 1915.
    15. 15. Haddow AJ. Заметка о появлении Aedes ( Stegomyia ) simpsoni Theobald в пологе тропического леса в округе Бвамба, Уганда.Ann Trop Med Parasitol. 1950 Октябрь; 44 (3): 238–41. pmid: 24538825
    16. 16. Haddow AJ. Естественное течение желтой лихорадки в Африке. Труды Королевского общества Эдинбурга Раздел B: Биологические науки. 1969; 70 (03): 191–227.
    17. 17. Gillett JD. Повадки комара Aedes ( Stegomyia ) simpsoni (Theobald) в связи с эпидемиологией желтой лихорадки в Уганде. Ann Trop Med Parasitol. 1951; 45 (2): 110–21. pmid: 14878392
    18. 18.Gillett JD. Дальнейшие исследования поведения при укусе Aedes ( Stegomyia ) simpsoni Theobald в Уганде. Ann Trop Med Parasitol. 1955; 49 (2).
    19. 19. Mukwaya LG. Предпочтение хозяина в комарах вида Aedes ( Stegomyia ) с особым предпочтением антропофильных форм Ae . ( Stegomyia ) simpsoni Theo. ( Diptera : Culicidae ) в Уганде: докторская диссертация.Университет Восточной Африки; 1971.
    20. 20. Mukwaya LG. Генетический контроль кормовых предпочтений комаров Aedes ( Stegomyia ) simpsoni и aegypti . Physiol Entomol. 1977. 2 (2): 133–45.
    21. 21. Mahaffy AF, Smithburn KC, Jacobs HR, Gillett JD. Желтая лихорадка в Западной Уганде. Trans R Soc Trop Med Hyg. 1942; 36 (1): 9–20.
    22. 22. Хуан И-М. Aedes ( Stegomyia ) simpsoni комплекс в Эфиопии с обозначением лектотипа для simpsoni (Theobald) ( Diptera : Culicidae ).Mosq Syst. 1979; 11 (3): 221–34.
    23. 23. Хуанг Ю.М. Aedes ( Stegomyia ) bromeliae ( Diptera : Culicidae ), переносчик вируса желтой лихорадки в Восточной Африке. J Med Entomol. 1986. 23 (2): 196–200. pmid: 3701804
    24. 24. Юпп П.Г., Кемп А. Вариация морфологии копытца и идентификация Aedes ( Stegomyia ) demeilloni / segermanae и Aedes ( Stegomyia ) simpsoni / bromelia168 ) в Южной Африке.J Am Mosq Control Assoc. 1999. 15 (1): 86–8. pmid: 10342277
    25. 25. Lutwama JJM, Louis Godfrey Вариация морфологических признаков взрослых особей комплекса Aedes ( Stegomyia ) simpsoni из Уганды, Кении и Южной Африки ( Dipteria : Culicidae ). Mosq Syst. 1994. 26 (3): 145–57.
    26. 26. Хуан И-М. Подрод Stegomyia из Aedes в Афротропической области с определителями вида ( Diptera : Culicidae ).Zootaxa. 2004; 700: 1–120.
    27. 27. Mukwaya LG, Kayondo JK, Crabtree MB, Savage HM, Biggerstaff BJ, Miller BR Генетическая дифференциация в векторе вируса желтой лихорадки, комплекс Aedes simpsoni , в Африке: изменение последовательности во внутренних транскрибируемых спейсерах рибосомальной ДНК антропофильных и неантропофильных населения. Насекомое Mol Biol. 2000. 9 (1): 85–91. pmid: 10672075
    28. 28. Уолтер К.С., Браун Дж. Э., Пауэлл Дж. Р. Разделение микрообитаний Aedes simpsoni ( Diptera : Culicidae ).J Med Entomol. 2014. 51 (3): 596–604. pmid: 24897852
    29. 29. Hebert PDN, Cywinska A, Ball SL, deWaard JR. Биологическая идентификация с помощью штрих-кодов ДНК. Труды Лондонского королевского общества B: биологические науки. 2003. 270 (1512): 313–21.
    30. 30. Hebert PDN, Ratnasingham S, de Waard JR. Штрих-кодирование жизни животных: расхождения субъединицы 1 цитохром с оксидазы среди близкородственных видов. Труды Лондонского королевского общества B: биологические науки. 2003; 270 (Приложение 1): S96 – S9.
    31. 31. Линтон И.М., Пекор Дж.Э., Портер С.Х., Митчелл Л.Б., Гарсон-Морено А., Фоли Д.Х. и др. Комары восточной части Амазонки, Эквадор: биоразнообразие, биономика и штрих-коды. Mem Inst Oswaldo Cruz. 2013; 108 (Приложение 1): 100–9. pmid: 24473809
    32. 32. Funk DJ, Omland KE. Парафилия на уровне видов: частота, причины и последствия на основе анализа митохондриальной ДНК животных. Ежегодный обзор экологии, эволюции и систематики. 2003. 34 (1): 397–423.
    33. 33.Уолтон С., Шарп Р., Причард С.Дж., Телвелл, штат Нью-Джерси, Бутлин Р.К. Молекулярная идентификация видов комаров. Biol J Linn Soc. 1999. 68 (1–2): 241–56.
    34. 34. Хюльсенбек JP, Бык JJ, Каннингем CW. Объединение данных в филогенетическом анализе. Trends Ecol Evol. 1996. 11 (4): 152–8. pmid: 21237790
    35. 35. Коллинз Ф. Х., Паскевиц С. М.. Обзор использования рибосомальной ДНК (рДНК) для дифференциации загадочных видов Anopheles . Насекомое Mol Biol. 1996; 5 (1): 1–9.pmid: 8630529
    36. 36. Арнхейм Н., Кристал М., Шмикель Р., Уилсон Г., Райдер О., Циммер Э. Молекулярные доказательства генетического обмена между рибосомными генами на негомологичных хромосомах у человека и обезьян. Труды Национальной академии наук. 1980. 77 (12): 7323–7.
    37. 37. Ляо Д. Согласованная эволюция: молекулярный механизм и биологические последствия. Am J Hum Genet. 1999. 64 (1): 24–30. pmid: 99
    38. 38. Яо Х, Сонг Дж., Лю Ц., Ло К., Хань Дж., Ли И и др.Использование области ITS2 в качестве универсального штрих-кода ДНК для растений и животных. PLoS ONE. 2010; 5 (10): e13102. pmid: 20957043
    39. 39. Кресс В.Дж., Вурдак К.Дж., Циммер Е.А., Вейгт Л.А., Янзен Д.Х. Использование штрих-кодов ДНК для идентификации цветущих растений. Proc Natl Acad Sci U S. A. 2005; 102 (23): 8369–74. pmid: 15928076
    40. 40. Уолтон С., Сомбун П., О’Лафлин С.М., Чжан С., Харбах Р.Э., Линтон Ю.М. и др. Генетическое разнообразие и молекулярная идентификация видов комаров в группе Anopheles maculatus с использованием области ITS2 рДНК.Infect, Genet Evol. 2007. 7 (1): 93–102.
    41. 41. Prakash A, Walton C, Bhattacharyya DR, Loughlin SO, Mohapatra PK, Mahanta J. Молекулярная характеристика и идентификация видов вируса Anopheles и An . Комплексы minimus на северо-востоке Индии с использованием r-ДНК ITS-2 . Acta Trop. 2006. 100 (1–2): 156–61. pmid: 17118324
    42. 42. Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA и др. Ядерная рибосомная внутренняя транскрибируемая спейсерная область ( ITS ) как универсальный маркер штрих-кода ДНК для грибов.Труды Национальной академии наук. 2012. 109 (16): 6241–6.
    43. 43. Le Goff G, Brengues C, Robert V. Stegomyia комаров на Майотте, таксономическое исследование и описание Stegomyia pia n. sp. Паразит. 2013; 20:31. pmid: 24025625
    44. 44. Сурендран С., Сарма Д., Джуд П., Кемппайнен П., Кантакумаран Н., Гаджапати К. и др. Молекулярная характеристика и идентификация членов комплекса Anopheles subpictus в Шри-Ланке.Малар Дж. 2013; 12 (1): 304.
    45. 45. Folmer O, Black M, Hoeh W., Lutz R, Vrijenhoek R. ДНК-праймеры для амплификации митохондриальной субъединицы I цитохром с оксидазы из различных беспозвоночных многоклеточных. Мол Мар Биол Биотехнология. 1994; 3 (5): 294–9. pmid: 7881515
    46. 46. Crabtree MB, Savage HM, Miller BR. Разработка анализа видовой диагностики полимеразной цепной реакции для идентификации Culex векторов вируса энцефалита Сент-Луиса на основе межвидовой изменчивости последовательностей в спейсерах рибосомной ДНК.Am J Trop Med Hyg. 1995. 53 (1): 105–9. pmid: 7625528
    47. 47. Браун Дж. Э., Эванс Б. Р., Чжэн В., Обас В., Баррера-Мартинес Л., Эгизи А. и др. Воздействие человека сформировало историческую и недавнюю эволюцию комара Aedes aegypti , лихорадочного денге и комара желтой лихорадки. Эволюция. 2014; 68 (2): 514–25. pmid: 24111703
    48. 48. Мессинг Дж. Новые векторы M13 для клонирования. Методы Энзимол. 1983; 101: 20–78. pmid: 6310323
    49. 49. Кирс М., Мойр Р., Уилсон А., Стоунз-Хавас С., Чунг М., Стуррок С. и др.Geneious Basic: интегрированная и расширяемая настольная программная платформа для организации и анализа данных последовательностей. Биоинформатика. 2012. 28 (12): 1647–9. pmid: 22543367
    50. 50. Flot JF. Seqphase: веб-инструмент для взаимного преобразования файлов ввода / вывода фазы и выравнивания последовательностей fasta. Ресурсы молекулярной экологии. 2010. 10 (1): 162–6. pmid: 21565002
    51. 51. Стивенс М., Смит Н.Дж., Доннелли П. Новый статистический метод реконструкции гаплотипа из данных о населении.Am J Hum Genet. 2001. 68 (4): 978–89. pmid: 11254454
    52. 52. Тамура К., Стечер Г., Петерсон Д., Филипски А., Кумар С. MEGA6: Анализ молекулярной эволюционной генетики, версия 6.0. Mol Biol Evol. 2013. 30 (12): 2725–9. pmid: 24132122
    53. 53. Дарриба Д., Табоада Г. Л., Доалло Р., Посада Д. jModelTest 2: Дополнительные модели, новая эвристика и параллельные вычисления. Нат методы. 2012; 9 (8): 772. pmid: 22847109
    54. 54. Guindon S, Gascuel O. Простой, быстрый и точный алгоритм для оценки крупных филогений по максимальной вероятности.Syst Biol. 2003. 52 (5): 696–704. pmid: 14530136
    55. 55. Excoffier L, Lischer HE. Arlequin Suite ver 3.5: новая серия программ для проведения популяционного генетического анализа под Linux и Windows. Ресурсы молекулярной экологии. 2010. 10 (3): 564–7. pmid: 21565059
    56. 56. Мэддисон WP. Генные деревья в породных деревьях. Syst Biol. 1997. 46 (3): 523–36.
    57. 57. Хлаинг Т., Тун-Лин В., Сомбун П., Сочеат Д., Сетха Т., Мин С. и др. Митохондриальные псевдогены в ядерном геноме комаров Aedes aegypti : значение для прошлых и будущих популяционных генетических исследований.BMC Genetics. 2009; 10: 11. pmid: 19267896
    58. 58. Лаймо И.Н., Фергюсон Х.М. Экологические и эволюционные детерминанты выбора вида хозяина у комаров-переносчиков. Trends Parasitol. 2009. 25 (4): 189–96. pmid: 19269900
    59. 59. Мутеби Дж. П., Барретт ADT. Эпидемиология желтой лихорадки в Африке. Microb Infect. 2002. 4 (14): 1459–68.
    60. 60. Эллис Б.Р., Санг Р.С., Хорн К.М., Хиггс С., Вессон Д.М. Восприимчивость к вирусу желтой лихорадки двух комаров-переносчиков из Кении, Восточная Африка.Trans R Soc Trop Med Hyg. 2012; 106 (6): 387–9. pmid: 22521217
    61. 61. Сери С., Андрал Л., Пуарье А., Линдрек А., Нери П. Этюды о желтом фионе в Эфиопии. 6. Эпидемиологический этюд. Bull WHO.1968; 38 (6): 879–84. pmid: 5303663
    62. 62. Жермен М., Монат П., Брайан Дж., Салаун Дж. Дж., Ренодет Дж. Вирус желтой лихорадки в Гамбии, 1978–1979: энтомологические аспекты и эпидемиологические корреляции. Am J Trop Med Hyg. 1980. 29 (5): 929–40. pmid: 7435794
    63. 63.Ли В.Х., Мур Д.Л. Переносчики эпидемии желтой лихорадки 1969 года на плато Джос, Нигерия. Bull WHO. 1972; 46 (5): 669–73. pmid: 4403105
    64. 64. Порт GR, Wilkes TJ. Aedes ( Diceromyia ) furcifer / taylori и вспышка желтой лихорадки в Гамбии. Trans R Soc Trop Med Hyg. 1979; 73 (3): 341–34. pmid: 473332
    65. 65. Germain M, Cornet M, Mouchet J, Monath TP, Hervé J-P, Salaün JJ и др. Последние достижения в исследованиях лесной желтой лихорадки в Западной и Центральной Африке.Бюллетень Института Пастера. 1982; 80 (4): 315–30.
    66. 66. Weaver SC, Reisen WK. Настоящие и будущие арбовирусные угрозы. Antiviral Res. 2010. 85 (2): 328–45. pmid: 19857523
    67. 67. Резза Г., Николетти Л., Анджелини Р., Роми Р., Финарелли А.С., Паннинг М. и др. Заражение вирусом чикунгунья в Италии: вспышка в регионе с умеренным климатом. Ланцет. 2007. 370 (9602): 1840–6.
    68. 68. Thiboutot MM, Kannan S, Kawalekar OU, Shedlock DJ, Khan AS, Sarangan G, et al.Чикунгунья: Возможная эпидемия? PLoS Negl Trop Dis. 2010; 4 (4): e623. pmid: 20436958
    69. 69. Pialoux G, Gaüzère B.-A, Jauréguiberry S, Strobel M. Chikungunya, эпидемический арбовироз. Ланцетные инфекционные болезни. 2007. 7 (5): 319–27. pmid: 17448935
    70. 70. Josseran L, Paquet C, Zehgnoun A, Caillere N, Le Tertre A, Solet J-L и др. Вспышка болезни чикунгунья, остров Реюньон. Emerg Infect Dis. 2006. 12 (12): 1994–5. pmid: 17354339
    71. 71.Ван-Май К.Л., Клодин Р., Анита Т., Эмили Р., Анн-Лор Б., Анри-Пьер М. и др. Вирус Зика, Французская Полинезия, южная часть Тихого океана, 2013. Журнал новых инфекционных заболеваний. 2014; 20 (6): 1084.
    72. 72. Vireak H, Chadwick YY, Ly S, Andrew DH, Amelia PTdR, Robert BT и др. Инфекция, вызванная вирусом Зика, Камбоджа, 2010. Журнал новых инфекционных заболеваний. 2012; 18 (2): 349.
    .